Tags:
create new tag
, view all tags

wnt11

wingless-type MMTV integration site family, member 11

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName wnt11
Aliases ENSDARG:ENSDARG00000004256; cb748, slb, silberblick
Description wingless-type MMTV integration site family, member 11
GenomicLocation chromosome 5 38113768-38120280 forward strand
ExternalIDs Entrez:30139; EMBL:AF067429; UniGene:75830; ZFIN:ZDB-GENE-990603-12;
TranscriptID ENSDART:ENSDART00000013590
mRNA NCBI:NM_001144804
GeneDescription wnt11 is a member of MMTV integration site family. These proteins have been implicated in oncogenesis and other developmental processes.
GeneFunction Heisenberg et al.(2000) showed that the zebrafish silberblick (slb) locus encodes Wnt11 and the slb/wnt11 activity is required for cells to undergo correct convergent extension movements during gastrulation. They further showed that slb phenotype was resued by a truncated form of Dishevelled that does not signaling through the canonical Wnt pathway. Ulrich et al.(2005) showed that wnt11 functions during zebrafish gastrulation by regulating the cohesion of mesodermal and endodermal (mesendoderm) progeniotor cells. They further demonstrated that wnt11 activity in gastrulation is mediated by the GTPase Rab5, a key regulator of endocytosis. Cavodeassi et al.(2005) showed that two branches of the wnt signaling pathway coordinate cell fate determination with cell
GeneCloning It is contained in clone MGC:193977 (Vector: pCR4-TOPO forward) and [BAC] CH73-223D24
GeneStructure The gene encodes for a single transcript. the transcript ENSDART00000013590 has 5 exons and is 2132bps in length . The protein product ENSDARP00000012233 consists of 353 residues.
Protein ENSDARP00000012233
ProteinDomainandFamilies has domain InterPro:IPR005817; InterPro:IPR018161;
Motifs has motif Prosite:PS00246; PFAM:PF00110; PRINTS:PR01349;
Expression ArrayExpress:ENSDARG00000004256;
GeneOntology GO:0005576; GO:0005886; GO:0005786; GO:0045045; GO:0007223; GO:0007275; GO:0016337; GO:0030100; GO:0042074; GO:0048048; GO:0016055; GO:0008104; GO:0009968; GO:0007507; GO:0000132; GO:0060027; GO:0007417; GO:0016477; GO:0004871;
Orthologs ENTREZ:7481
VariationAndRepeats

DisordersAndMutations Heisenberg et al.( 1997) demonstrated that Zebrafish silberblick mutant has disrupted wnt11 gene. Slb mutant showed abnormal extension of axial tissue results in cyclopia and other midline defects in the head. In slb mutants extension of the axial mesendoderm and overlying ventral central nervous system is disturbed, resulting in fusion of the eyes later in development .Morpholinos MO1-wnt11 (5' - GAAAGTTCCTGTATTCTGTCATGTC - 3'), MO2-wnt 11 ( 5' - GTTCCTGTATTCTGTCATGTCGCTC - 3') and MO3-wnt11 (5' - ACTCCAGTGAAGTTTTTCCACAACG - 3') are directed against wnt11. ZFINID:ZDB-GENO-080222-4; ZFINID:ZDB-GENO-091020-1; ZFINID:ZDB-GENO-070316-4; ZFINID:ZDB-GENO-070911-1; ZFINID:ZDB-GENO-980202-1037; ZFINID:ZDB-GENO-090112-5; ZFINID:ZDB-GENO-070305-3; ZFINID:ZDB-GENO-071130-2; ZFINID:ZDB-GENO-980202-1408; ZFINID:ZDB-GENO-051026-1; ZFINID:ZDB-GENO-070907-1; ZFINID:ZDB-GENO-050826-1; ZFINID:ZDB-GENO-100715-12; ZFINID:ZDB-GENO-100614-3; ZFINID:ZDB-GENO-100412-13; ZFINID:ZDB-GENO-100412-21; ZFINID:ZDB-GENO-100614-4; ZFINID:ZDB-GENO-080512-3; ZFINID:ZDB-GENO-101203-3; ZFINID:ZDB-GENO-080512-2; ZFINID:ZDB-GENO-101203-4; ZFINID:ZDB-GENO-070514-4; ZFINID:ZDB-GENO-070907-2;
RelatedPubMedArticles Heisenberg, C.;Tada, M.; Rauch, G.; Saude, L.; Concha, M.L.; Geisler, R.; Stemple, D.L.; Smith, J.C.; Wilson, S.W.: Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature.405, 2000. Ulrich, F.; Krieg, M.; Schötz, E.M.; Link, V.; Castanon, I.; Schnabel, V.; Taubenberger, A.; Mueller, D.; Puech, P.H.; Heisenberg, C.P.: Wnt11 functions in gastrulation by controlling cell cohesion through Rab5c and E-cadherin. Dev Cell. 9(4):555-64,2005. PMID:16198297 Cavodeassi, F.; Carreira-Barbosa, F.; Young, R.M.; Concha, M.L.; Allende, M.L.; Houart, C.; Tada, M.; Wilson, S,W.: Early stages of zebrafish eye formation require the coordinated activity of Wnt11, Fz5, and the Wnt/beta-catenin pathway. Neuron. 7;47(1):43-56,2005. PMID:15996547 Muyskens, J.B.; Kimmel, C.B.: Tbx16 cooperates with Wnt11 in assembling the zebrafish organizer. Mech Dev. 124(1):35-42,2007. PMID:17081734 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-07-27 - PrernaBudakoti
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort