Tags:
create new tag
, view all tags

wnt10b

wingless-type MMTV integration site family, member 10b

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName wnt10b
Aliases ENSDARG:ENSDARG00000040925; Protein Wnt-10b precursor. [Source:Uniprot/SWISSPROT;Acc:Q801F7]; wnt[d]; Zwnt[d]; wnt10br; wnt10b
Description wingless-type MMTV integration site family, member 10b
GenomicLocation chromosome 23 27882108-27888406 reverse strand
ExternalIDs Entrez:30308; EMBL:AY182171; UniGene:88562; ZFIN:ZDB-GENE-980526-524;
TranscriptID ENSDART:ENSDART00000059974; ENSDART:ENSDART00000077911
mRNA NCBI:NM_178219
GeneDescription Wnt signals have been shown to be involved in multiple steps of vertebrate neural patterning. Zebrafish wnt10b gene is expressed in a pattern overlapping extensively with that of wnt1 during Midbrain-Hindbrain (MHB) development.
GeneFunction Lekven AC et al. (2003) found that zebrafish wnt10b is expressed in a pattern substantially overlapping that of wnt1. They generated a zebrafish line carrying a deficiency allele for wnt1, wnt10b and showed that zebrafish wnt1 and wnt10b are not required for the formation of the midbrain and cerebellum. They further showed that wnt1 and wnt10b are at least partially functionally redundant in their capacity to regulate gene expression at the MHB. Finally, they showed through double mutant analyses that zebrafish lacking wnt1 and wnt10b, though they retain expression of pax2.1 and fgf8, are sensitized to reductions in the levels of these genes.Buckles GR et al. (2004) through morpholino knockdown showed that in the absence of expression of Wnt1 and Wnt10b, Wnt3a is required for the formation of the MHB constriction. They showed that zebrafish embryos lacking Wnt3a, Wnt1 and Wnt10b, the expression of engrailed orthologs, pax2a and fgf8 is not maintained after mid-somitogenesis and undergoes extensive apoptosis in the midbrain and cerebellum anlagen beginning in mid-somitogenesis, which results in the absence of a significant portion of the midbrain and cerebellum.Riley BB et al. (2004) studied the roles of Wnt and Delta-Notch signaling in maintaining rhombomere boundaries as organizing centers in the zebrafish hindbrain and found several wnt genes like wnt1, wnt3a, wnt8b, and wnt10b that showed elevated expression at rhombomere boundaries. They found that rhombomere boundaries act as Wnt signaling centers required for precise metameric patterning during vertebrate hindbrain development.O’Hara et al. (2005) proposed that the regulation of Wnt10b along with other genes wnt1, wnt3a, pax8 and fgf8 is mediated by Lmx1b.1- and Lmx1b.2 which maintains cell survival in the isthmocerebellar region of the vertebrate central nervous system.
GeneCloning wnt10b Contained in:[BAC] DKEY-166N8
GeneStructure The gene encodes for two transcripts. The transcript ENSDART00000077911 Thas 7 exons and is 1082 bps in length.the protien product ENSDARP00000072377 consists of 314 residues The transcript ENSDART00000059974 has 4 exons and is 1515 bps in length. The protein product ENSDARP00000059973 consists of 427 residues.
Protein ENSDARP00000059973 ENSDARP00000072377
ProteinDomainandFamilies has domain InterPro:IPR005817; InterPro:IPR013302; InterPro:IPR018161;
Motifs has motif Prosite:PS00246; PFAM:PF00110;
Expression

GeneOntology GO:0005109;GO:0005109;GO:0005102;GO:0060070;GO:0045165;GO:0030182;GO:0016055;GO:0007275;GO:0030917;GO:0005615;GO:0005576;GO:0005578;
Orthologs GO:0005109;GO:0005109;GO:0005102;GO:0060070;GO:0045165;GO:0030182;GO:0016055;GO:0007275;GO:0030917;GO:0005615;GO:0005576;GO:0005578;
VariationAndRepeats

DisordersAndMutations ZFINID:ZDB-GENO-030409-1;ZFINID:ZDB-GENO-081230-4;ZFINID:ZDB-GENO-091207-3; MO1-wnt10b 5' - GGTAACTCCATTGCGTCGAACGCTT - 3'
RelatedPubMedArticles Lekven, AC; Buckles, GR; Kostakis, N; Moon, RT. (2003). Wnt1 and wnt10b function redundantly at the zebrafish midbrain-hindbrain boundary. Dev Biol. 254(2):172-87. PMID:12591239 .Buckles, GR; Thorpe, CJ; Ramel, MC; Lekven, AC. (2004). Combinatorial Wnt control of zebrafish midbrain-hindbrain boundary formation. Mech Dev. 121(5):437-47. PMID:15147762 .Riley, BB; Chiang, MY; Storch, EM; Heck, R; Buckles, GR; Lekven, AC. (2004). Rhombomere boundaries are Wnt signaling centers that regulate metameric patterning in the zebrafish hindbrain. Dev Dyn. 231(2):278-91. PMID:15366005 . O'Hara, FP; Beck, E; Barr, LK; Wong, LL; Kessler, DS; Riddle, RD. (2005). Zebrafish Lmx1b.1 and Lmx1b.2 are required for maintenance of the isthmic organizer. Development. 132(14):3163-73. Erratum in: Development. 132(15):3574. PMID:15944182 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-26 - PrernaBudakoti
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort