Tags:
create new tag
, view all tags

wnt1

wingless-type MMTV integration site family, member 1

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName wnt1
Aliases ENSDARG:ENSDARG00000055554; WNT-1; int-1; sb:eu647; zgc:194464; zgc:194478; wnt1
Description wingless-type MMTV integration site family, member 1
GenomicLocation chromosome 23 27892988-27898691 forward strand
ExternalIDs Entrez:30128; EMBL:BC163003; UniGene:85371; ZFIN:ZDB-GENE-980526-526;
TranscriptID ENSDART:ENSDART00000130491; ENSDART:ENSDART00000077931
mRNA NCBI:NM_001201398;
GeneDescription The WNT gene family include genes that encode for secreted signaling molecule. They have been implicated in oncogenesis and various developmental processes. They are known to be involved in the regulation of cell fate and patterning during embryogenesis.
GeneFunction Molven et al . (1991) isolated two lambda clones covering the coding region of wnt-1 from a zebrafish genomic library. They further showed that the zebrafish Wnt-1 proteins are highly conserved. They had further examined the expression in zebrafish by hybridizing a probe from wnt-1 to a northern blot of total RNA from various embryonic stages and showed that expression first appears 12-13h after fertilization, i.e. 2-3 h after gastrulation is completed and the time time when neural tube starts to differentiate; expression continues upto 40 h. Dorsky et al. (1998) reported that ectopic expression of wnt-1 in zebrafish causes an increase in the number of cells expressing neural crest markers. Lekven et al.(2003) showed that Zebrafish wnt1 and wnt10 expression patterns significantly overlap, with differences being observable at 24 hpf in the ventral portion of the Midbrain Hindbrain Boundary and the cerebellum. They further reported that morpholino knockdown of wnt1 does not reduce the expression of wnt10b, indicating that there is no linear relationship between the two in zebrafish. Amoyel et al. (2005) investigated the function of wnt-1 signaling that was known to be expressed by boundary and roof plate cells in the zebrafish hindbrain. They also showed that the bourndary and roof plate expression of wnt1contributes to upregulation of proneural and delta gene expression and neurogenesis in non-boundary regions .
GeneCloning wnt1 Contained in:[BAC] DKEY-166N8
GeneStructure It encodes for two transcriptsENSDART:ENSDART00000077931; consists of 4 exons and is of 1360 bps in length .the protien product ENSDARP:ENSDARP0000072397;has 370 residues. transcript ENSDART:ENASDART00000130491; consists of 5 exons and is of length 1128 bps in length .The protein product ENSDARP:ENSDARP000000110057; has 375 residues.
Protein ENSDARP00000110057 ENSDARP00000072397
ProteinDomainandFamilies has domain InterPro:IPR009139; InterPro:IPR005817; InterPro:IPR018161;
Motifs has motif Prosite:PS00246; PFAM:PF00110; PRINTS:PR01349; PRINTS:PR01841;
Expression ArrayExpress:ENSDARG00000055554;
GeneOntology GO:0005109;GO:0005102;GO:0060070;GO:0045165;GO:0030182;GO:0016055;GO:0030154;GO:0007275;GO:0007399;GO:0030917;GO:0035284;GO:0021587;GO:0021592;GO:0030902;GO:0005615;GO:0005576;GO:0005578;
Orthologs Entrez:7471;
VariationAndRepeats

DisordersAndMutations ZFINID:ZDB-GENO-030409-1;ZFINID:ZDB-GENO-081230-4;ZFINID:ZDB-GENO-091207-3;MO1-wnt1 5' - AGCAACGCGAGAACCCGCATGATAT - 3',MO2-wnt1 5' - AAGCAACGCGAGAACCCGCATGATA - 3',MO3-wnt1 5' - GATTCACGCAATAGCACACACTGTC - 3'
RelatedPubMedArticles Molvel, A.; Njolstad, P.R.; Fjose, A.: Genomic structure and restricted neural expression of the zebrafish wnt-1 (int-1) gene. The EMBO Journal.10(4): 799-807,1991. PMID:2009859 Dorsky, R.I.; Moon, R.T.; Raible. D. W.: Control of neural crest cell fate by the Wnt signaling pathway. Nature. 396 (6709):370-3,1998. PMID:9845073 Lekven, A.C.; Buckles, G.; Kostakis, N.; Moon, R.T.: wnt1 and wnt10b function redundantly at the zebrafish midbrain-hindbrain boundary. Dev. Biol. 254:172-187,2003. PMID:12591239 Amoyel. M.; Cheng, Y.; Jiang, Y.; Wilkinson, D. G.: Wnt1 regulated neurogenesisand mediates lateral inhibition of boundary cell specification in the zebrafish hindbrain. Development. 132:775-78,2002. PMID:12167410 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - PrernaBudakoti
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort