Tags:
create new tag
, view all tags

tfr1a

transferrin receptor 1a

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName tfr1a
Aliases ENSDARG:ENSDARG00000058784; cia, chianti, transferrin receptor 1a
Description transferrin receptor 1a
GenomicLocation chromosome 2 4738463-4756752 reverse strand
ExternalIDs Entrez:494477; EMBL:BX663506; UniGene:87179; ZFIN:ZDB-GENE-041220-1;
TranscriptID ENSDART:ENSDART00000081717; ENSDART:ENSDART00000139602
mRNA NCBI:NM_001009917
GeneDescription

GeneFunction Ransom et al. (1996) observed that mutations in following genes, chardonnay, chianti, grenache, sauternes, weißherbst and zinfandel, and two additional mutations result in hypochromic blood cells which further decrease in number as development proceeds.Wingert et al. (2004) characterized and cloned the chianti (cia) mutant phenotype. They showed that cia encodes an erythroid-specific isoform of transferrin receptor 1 (tfr1a) that is solely required for iron acquisition by differentiating erythrocytes. They found that zebrafish have undergone and retained a duplication of Tfr1 during teleost evolution, adding tfr1a and tfr1b to the growing list of gene duplicates in teleosts.Lumsden et al. (2007) found that on knocking down the Huntington’s disease (HD) gene in zebrafish, transferrin receptor 1 transcripts were increased suggesting cellular iron starvation
GeneCloning Wingert et al. (2004) characterized and cloned the chianti (cia) mutant phenotype.
GeneStructure This gene encodes for 2 transcripts.The transcript (ENSDART00000081717) consists of 17 exons and is 2390 bps in length. The protein product (ENSDARP00000076156) consists of 770 residues. The transcript (ENSDART00000139602) consists of 10 exons and is 1 405 bps in length. The protein product (ENSDARP00000122069) consists of 468 residues.
Protein ENSDARP00000076156 ENSDARP00000122069
ProteinDomainandFamilies InterPro:IPR007365; InterPro:IPR003137;
Motifs PFAM:PF02225; PFAM:PF04253;
Expression ArrayExpress:ENSDARG00000058784;
GeneOntology GO:0016021; GO:0006508; GO:0006879; GO:0030218; GO:0042541; GO:0035162; GO:0008233; GO:0004998; GO:0004872;
Orthologs Entrez:[Gene:7037]
VariationAndRepeats RSID:rs40704371; RSID:rs40888350;
DisordersAndMutations The Chianti (cia) is an ENU mutant and provides a useful genetic model to study the role of Tfr1 in erythropoiesis in the absence of other developmental defectsMO1-tfr1a 5' - AGATGGTTGTCCTGGCTTGATCCAT - 3', MO2-tfr1a 5' - ACACCTTCGAGTGGACGAAGTAACAC - 3' were used to knockdown tfr1a gene.
RelatedPubMedArticles Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DA, Odenthal J, van Eeden FJ, Jiang YJ, Heisenberg CP, Kelsh RN, Furutani-Seiki M, Vogelsang E, Beuchle D, Schach U, Fabian C, Nüsslein-Volhard C. The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development. 1996 Dec;123:1-36. PMID:9007226
Ransom DG, Haffter P, Odenthal J, Brownlie A, Vogelsang E, Kelsh RN, Brand M, van Eeden FJ, Furutani-Seiki M, Granato M, Hammerschmidt M, Heisenberg CP, Jiang YJ, Kane DA, Mullins MC, Nüsslein-Volhard C. Characterization of zebrafish mutants with defects in embryonic hematopoiesis. Development. 1996 Dec;123:311-9. PMID:9007251
Wingert RA, Brownlie A, Galloway JL, Dooley K, Fraenkel P, Axe JL, Davidson AJ, Barut B, Noriega L, Sheng X, Zhou Y, Zon LI. The chianti zebrafish mutant provides a model for erythroid-specific disruption of transferrin receptor 1. Development. 2004 Dec;131(24):6225-35. PMID:15563524
Lumsden AL, Henshall TL, Dayan S, Lardelli MT, Richards RI. Huntingtin-deficient zebrafish exhibit defects in iron utilization and development. Hum Mol Genet. 2007 Aug 15;16(16):1905-20. Epub 2007 Jun 13. PMID:17567778
Zeng J, Yan J, Wang T, Mosbrook-Davis D, Dolan KT, Christensen R, Stormo GD, Haussler D, Lathrop RH, Brachmann RK, Burgess SM. Genome wide screens in yeast to identify potential binding sites and target genes of DNA-binding proteins. Nucleic Acids Res. 2008 Jan;36(1):e8. Epub 2007 Dec 17. PMID:18086703 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-19 - ShrutiKapur
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort