Tags:
create new tag
, view all tags

tbx5

T-box 5

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName tbx5
Aliases ENSDARG:ENSDARG00000024894; zTbx5; tbx5.1; zf-tbx5
Description T-box 5
GenomicLocation chromosome 5 75451438-75476894 forward strand
ExternalIDs Entrez:30071; UniGene:81302; ZFIN:ZDB-GENE-991124-7;
TranscriptID ENSDART:ENSDART00000037681; ENSDART:ENSDART00000037691
mRNA NCBI:NM_130915
GeneDescription Tbx5 belong to the T-box gene family and has been known to play important roles in forelimb identity and heart development.
GeneFunction Tamura et al. (1999) had identified two new members of the T-box gene family tbx4 and tbx5 from zebrafish, Danio rerio. They further reported that their amino acid sequences shared high homology with the mouse, chick, and newt orthologs. They had further shown through in situ hybridization that these genes were expressed in the eye and fin buds. Tbx5 transcripts were confined in the pectoral fin bud.Ruvinsky et al. (2000) had screened the 33-hpf embryonic cDNA library and isolated two clones, one of which was identified as a tbx4-like gene and the other was preliminarily designated as tbx5. They further studied the expression of tbx5 as well as tbx4 using in situ hybridization. They observed that tbx4 as well as tbx5 genes were expressed in a highly restricted patterns during embryonic development. They observed that tbx5 was expressed in heart tissue , the expression being detected as two bilateral stripes in the anterior plate mesoderm at 16-hpf. They also reported that the expression was maintained as these primordial merged at the midline and subsequently went through heart tube and chamber formation, persisiting until 3 dpf. Tbx4 and Tbx5 expression was alos detected in nested domains in the developing meuroepithelium of the zebrafish retina. They further detected the Tbx5 expression in two bilaterally symmetrical cell sheets on the dorsal surface of the yolk cell at an axial level corresponding to somites 1-4. This was consistent with the expression in the larval pectoral fin field prior to the emergence of a morphologically evident fin bud.Ng et al. (2002) had shown that tbx5 is both necessary and sufficient for limb outgrowth. They found that Tbx5 functions downstream of WNT signaling to regulate Fgf10 which in turn maintains Tbx5 expression during limb outgrowth. Their results further indicated Tbx5 and Wnt2b functions together to initiate and specify forelimb outgrowth and identity. To better understand the role of Tbx genes , they performed loss-of-function experiments in zebrafish by using morpholino oligonucledtides which were injected into one-cell stage zebrafsih embryos. They further focused on Tbx5. They had shown that injection of Tbx5 morpholino gave a range altered fin phenotypes depending on the amount injected. They showed that with the highest non-toxic levels of injected morpholino (10ng), the most common phenotype was complete loss of pectoral fins. They further confirmed through cartilage staining that these embryos lacked pectoral fin structures and the shoulder girdle. They further had shown that tbx5 loss-of-function experiments suggested that tbx5 plays a role in limb initiation and outgrowth.Begemann et al. (2000) used RT-PCR approach, exploiting the high degree of sequence conservation within the T-box domain of various vertebrate orthologues, to isolate a zebrafish tbx5 cDNA. They further studied the expression of tbx5 using in situ hybridization. They observed that at 6-7 somite stage tbx5 was expressed in the temporal halves of the optic primordial. They noted further that this expression intensified rapidly and between the 15-20 somite stage was confined to the posterior half of the neural retina. Between 24 and 36 hpf, the tbx5 expression was restricted to a narrow sector of the meuroepithelium that appeared to be in contact with the lens and was directly oipposed to the choroid fissure. The expression in th eye was lost by 48 hpf.
GeneCloning Tamura et al. 1999 isolated zebrafish tbx5 by PCR amplification using degenerate primers The amplified product was clonedinto PCR-script (Stratagene). After cloning and sequencing the PCR fragment was subsequently used to screen a cDNA library derived from 24-h stage zebrafish embryo (Stratagene) at high stringency. The positive clone that was obtained was sequenced and used for in situ hybridization.Begemann et al., 2000 synthesized partially degenerate primers to a portion of T-box, coding for amino acid sequences which are identical in mouse and human tbx5 and further contained XhoI and ClaI restriction sites that facilitated subcloning of the 366 bp amplification product into pBluescript SK.
GeneStructure The gene tbx5a codes for 3 transcripts. The first transcript (ENSDART00000037691) consists of 9 exons out of which 8 are coding exons and the transcript length is 2,059 bps while the protein product (ENSDARP00000033053) with a translation lengthof 492 residues. The second transcript (ENSDART00000037681) codes for 10 exons out of which 9 are coding with a length of 2054bps and protein product ENSDARP00000033639) of 484 residues. the third transcript (ENSDART00000114947) consists of 6 exons with a length of 768 bps but doesnt code for protein. The gene tbx5b encodes for one transcript (ENSDART00000125638) which consists of 9 exons out of which 8 are coding exons with a transcript length of 1,636 bps and codes for a protein ( ENSDARP00000107718) with translation length of 430 residues.
Protein ENSDARP00000033639 ENSDARP00000033053
ProteinDomainandFamilies has domain InterPro:IPR001699; InterPro:IPR002070;
Motifs has motif Prosite:PS01264; Prosite:PS01283; PFAM:PF00907; PRINTS:PR00937; PRINTS:PR00938; UniProt:TBX5_DANRE;
Expression ArrayExpress:ENSDARG00000024894
GeneOntology GO:0005634; GO:0006355; GO:0006353; GO:0006350; GO:0031564; GO:0003700; GO:0003677; GO:0030528;
Orthologs Entrez: [Gene:6910]
VariationAndRepeats tbx5a: rs179372370 rs179372373 rs179372377 rs179372378 rs179372380 rs179372381 rs179372382 rs179372384 rs179372386 rs179372387 rs179372394 rs179372395 rs179372398 rs179372405 rs179372406 rs179372407 rs179372408 rs179372411 rs179372414 rs179372416 rs179372422 rs179372424 rs179372427 rs179372428 rs179372432 rs179372439 rs179372440 rs179372441 rs179372442 rs179372444 rs179372445 rs179372447 rs179372450 rs179372451 rs179372455 rs179372456 rs179372458 rs179372462 rs179372466 rs179372467 rs179372468 rs179372471 rs179372474 rs179372476 rs179372478 rs179372481 rs179372482 rs179372483 rs179372484 rs179372491 rs179372492 rs179372493 rs179372500 rs179372504 rs179372505 rs179372509 rs179372515 rs179372516 rs179372517 rs179372530 rs179372532 rs179372537 rs179372539 rs179372540 rs179372541 rs179372542 rs179372543 rs179372547 rs179372550 rs179372552 rs179372553 rs179372556 rs179372559 rs179372560 rs179372566 rs179372567 rs179372570 rs179372573 rs179372574 rs179372580 rs179372583 rs179372584 rs179372586 rs179372587 rs179372588 rs179372589 rs179372590 rs179372598 rs179372599 rs179372604 rs179372606 rs179372608 rs179372611 rs179372612 rs179372613 rs179372614 rs179372615 rs179372616 rs179372617 rs179372618 rs180034355 rs180034356 rs180034357 rs180034359 rs180034360 rs180173549 rs180173550 tbx5b:rs40722372 rs40675905 rs40604408 rs40993214 rs40961350 rs40608737 rs40607637 rs40617048 rs40694989 rs41037991 rs40706631 rs40964295
DisordersAndMutations Garrity et al. (2002) isolated the recessive lethal mutant heartstrings, which lacked pectoral fins and exhibited severe cardiac dysfunction, which initiated with a slow heart rate and progressed to a stretched, non-functional heart. They mapped and cloned the heartstrings mutation and found that it encoded the zebrafish ortholog of the TBX5 gene. They further found that heartstrings mutation causes premature termination at amino acid 316. They also observed that homozygous mutant embryos never developed pectoral fin buds and that they did not express several markers of early fin differentiation.. By studying these mutations they suggested that Tbx5 functions very early in the pectoral fin induction pathway. They further caused reduction of Tbx5 using morpholino and found that it causes fin malformations. This further revealed that Tbx5 is involved in coordinating the axes of fin outgrowth.Morpholinos MO1-tbx5 (5' - GAAAGGTGTCTTCACTGTCCGCCAT - 3' ), MO2-tbx5 (5' - CCTGTACGATGTCTACCGTGAGGC - 3' ), MO3-tbx5 (5' - GGTGTCTTCACTGTCCGCCATGTCG - 3' ).
RelatedPubMedArticles Tamura K., Yonei-Tamura S., Belmonte J.C.I. Differential expression of Tbx4 and Tbx5 in Zebrafish fin buds. Mechanisms of Development 87 (1999) 181-184. PMID:10495283 Ruvinsky I., Oates A.C., Silver L.M. The evolution of paired appendages in vertebrates : T-box genes in the zebrafish Dev Genes Evol (2000) 210: 82-91. PMID:10664151 3. Begemann G., Ingham P.W. Developmental regulation of Tbx5 in zebrafish embryogenesis. Mechanisms of Development 90 (2000) 299-304. PMID:10640716 Garrity D.M., Childs S., Fishman M.C. The heartstrings mutation in zebrafish causes hearty/fin Tbx5 deficiency syndrome Development 129, 4635-4645 (2002)Ng J.K., Kawakami Y., Buscher D., Raya A., Itoh T., koth C.M., Esteban C.R., Rodriguez-Leon J., Garrity D.M., Fishman M.C., Belmonte J. C. I. The limb identity gene Tbx5 promotes limb initiation by interacting with Wnt2b and Fge10. Development 129, 5161-5170 (2002). PMID:12399308 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-19 - ShrutiKapur
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort