Tags:
create new tag
, view all tags

tbx2b

T-box 2b

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName tbx2b
Aliases ENSDARG:ENSDARG00000006120;
Description T-box 2b
GenomicLocation chromosome 15 26713282-26720228 forward strand
ExternalIDs Entrez:30253; EMBL:AF179405; UniGene:8233; ZFIN:ZDB-GENE-990726-27;
TranscriptID ENSDART:ENSDART00000122101; ENSDART:ENSDART00000005491
mRNA NCBI:NM_131051
GeneDescription Tbx2 belong to the T-box gene family and has been known to play important roles in limb identity .
GeneFunction Ruvinsky te al. (2000) studied the expression of tbx2 gene in the zberafish embryos. The expression of the zebrafish tbx2 gene was observed in many tissues of the ectodermal and mesodermal origin during embryogenesis. The tbx2 transcript were first detected at bud stage in the ventral prosencephalon and along the length of the notochord. They further observed that as the segmentation proceeded tbx2 was expressed in the optic primordial, the otic placodes, two rows of dorsally placed neuron in the slinal cord and diffusely in cells over the yolk lying ventrally to the tail bud. Early in segmentation period, tbx2 was expressed in a smaller cluster of cells in the dorsal diencephalon, the primordial of trigeminal sensory ganglia and the posterior notochord.The expression was also observed in the developing fins of the zebrafish.
GeneCloning tbx2b contained in: [BAC] CH211-229G11,tbx2b Encodes: [EST] zeh1581 [cDNA] MGC:55196
GeneStructure This gene encodes 2 transcripts . the transcript ENSDART00000122101 consists of 7 exons and is 2616 bps in length. The protein ENSDARP00000107769 is 687 aa long. the second transcript ENSDART00000005491 consists of 8 exons. The length of transcript is 2016 bps and the protein ENSDARP00000020624 is 671 aa long.
Protein ENSDARP00000107769 ENSDARP00000020624
ProteinDomainandFamilies has domain InterPro:IPR002070; InterPro:IPR001699;
Motifs has motif Prosite:PS01264; Prosite:PS01283; PFAM:PF00907; PRINTS:PR00937; PRINTS:PR00938; UniProt:TBX2_DANRE;
Expression ArrayExpress:ENSDARG00000006120;
GeneOntology GO:0005634; GO:0006355; GO:0006353; GO:0006350; GO:0031564; GO:0007420; GO:0042074; GO:0048663; GO:0007155; GO:0030903; GO:0008283; GO:0046549; GO:0046548; GO:0003700; GO:0003677;
Orthologs Entrez:Gene:6909
VariationAndRepeats RSID:rs40785418; RSID:rs40952575,; RSID:rs41094432; RSID:rs40641180; RSID:rs41247043; RSID:rs40724179
DisordersAndMutations Morpholinos MO1-tbx2b (5' - CCTGTAAAAACTGGATCTCTCATCG - 3'), MO2-tbx2b ( 5' - GGAAAGGGTGGTAAGCCATCACAGT - 3'), MO3-tbx2b (5' - GGTAAGCCATCACAGTCCCTGTAAA - 3'), MO4-tbx2b ( 5' - AAAATATGGGTACATACCTTGTCGT - 3') and MO5-tbx2b (5' - GAGCGTGGAAAGGGTGGTAAGCCAT - 3') were designed and used against the tbx2 to study its effects in the zebrafish embryos.
RelatedPubMedArticles Ruvinsky, I.; Oates, A, C.; Silver, L, M.: The evolution of paired appendages in vertebrates : T-box genes in the zebrafish Dev Genes Evol (2000) 210: 82-91. PMID:10664151 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - ShrutiKapoor
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort