Tags:
create new tag
, view all tags

sox9b

SRY-box containing gene 9b

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName sox9b
Aliases ENSDARG:ENSDARG00000043923; fb18d01, wu:fb18d01(1)
Description SRY-box containing gene 9b
GenomicLocation chromosome 3 63179328-63184452 reverse strand
ExternalIDs Entrez:60642; EMBL:BC067133; UniGene:114501; ZFIN:ZDB-GENE-001103-2;
TranscriptID ENSDART:ENSDART00000064500; ENSDART:ENSDART00000124464
mRNA NCBI:NM_131644;
GeneDescription Sox9b tanscripts are present throughout the life-cycle of zebrafish and exhibit tissue-specific distribution during embryogenesis. Zygotic expression of sox9b occurs in the anterolateral margins and the midline of prospective dorsal neuroectoderm during late gastrulation.
GeneFunction Chiang et al. (2001) reported two sox9 genes in Zebrafish, sox9a and sox9b. They demonstrated the expression of sox9a in testis and that of sox9b in ovaries. The transcripts of both the genes were also detected in central nervous system, some sensory organs, the developing craniofacial skeleton, and pectoral fin buds in the embryo during the pharyngula and hatching periods.Li et al. (2002) showed zebrafish sox9b as an early marker for both cranial and trunk neural crest precursors. They evaluated the expression patterns of sox9b during embryogenesis and their analyses revealed the presence of sox9b transcripts throughout the life cycle of zebrafish, and exhibited tissue-specific distribution during embryogenesis. They suggested the resemblance of sox9b expression pattern and timing to that of fkd6, an early neural crest marker.Marí et al. (2005) cloned amh cDNA from zebrafish, studied its expression pattern in embryos, larvae, juveniles, and adults, and compared it to the expression patterns of sox9a, sox9b, and cyp19a1a. Their finding shows that zebrafish sox9b and sox8 were not co-expressed with amh in oocytes .Rau et al. (2006) showed the absence of iridophores in sox9b or sox9a/sox9b double mutants. They found out the role of Trap230 in sox9b activity and suggested for the specific interaction of trap230 with sox9 gene that can lead to tod phenotypes.Xiang et al. (2008) investigated the transcriptional response in developing zebrafish jaw after 2,3,7,8-Tetrachlorodibenzo-p-dioxime (TCDD) exposure using DNA microarrays and found out the reduction of sox9b transcript in the jaw. They did Morpholino knockdown of sox9b expression and demonstrated the partial reduction of sox9b that sufficiently produced TCDD-like jaw phenotype.
GeneCloning no data available
GeneStructure sox9b encodes for two transcript (ENSDART00000124464) consists of 5 exons and is 1227 bps in length.The protein product (ENSDARP00000111576) consists of 408residues. (ENSDART00000064500) consists of 3 exons and is 1888 bps in length. The protein product (ENSDARP00000064499) consists of 407 residues.
Protein ENSDARP00000064499 ENSDARP00000111576
ProteinDomainandFamilies InterPro:IPR009071; InterPro:IPR022151;
Motifs Prosite:PS50118; PFAM:PF00505; PFAM:PF12444;
Expression ArrayExpress:ENSDARG00000043923;
GeneOntology GO:0003677; GO:0048839; GO:0043049; GO:0051216; GO:0035118; GO:0050935; GO:0030318; GO:0043049;
Orthologs Entrez:6662;
VariationAndRepeats RSID:rs180040135; RSID:rs40738999; RSID:rs40664917; RSID:rs40967654; RSID:rs40911691; RSID:rs40901855; RSID:rs180040134; RSID:rs180040133; RSID:rs180040132
DisordersAndMutations ZFINID:ZDB-GENO-070219-2;ZFINID:ZDB-GENO-100428-3;ZFINID:ZDB-GENO-050322-1;ZFINID:ZDB-GENO-081106-1;ZFINID:ZDB-GENO-110419-6;ZFINID:ZDB-GENO-110525-7;ZFINID:ZDB-GENO-110425-1;ZFINID:ZDB-GENO-070321-1;ZFINID:ZDB-GENO-100311-10;ZFINID:ZDB-GENO-100311-9;Yan et al. (2002) produced a phenotype like jef mutant larvae, by inhibiting the splicing of sox9a transcript in wild-type embryos with splice site-directed morpholino antisense oligonucleotides.Intron1 splice donar junction AATGAATTACTCACCTCCAAAGTTTIntron 2 splice donar junction CGAGTCAAGTTTAGTGTCCCACCTGTheir analysis of dlx2 expression showed the neural crest specification and migration to be normal in jef (sox9a) embryos. They also suggested sox9a or its downstream targets, including extracellular matrix proteins to play morphogenetic roles in chondrogenesis.Yan et al. (2005) investigated the roles of sox9 in the development of neural crests and placods. They conducted a genotype-driven screening for the mutation that deletes sox9b activity and studied their phenotype. Then, they compared them with single and double-mutant combinations of jellyfish (jef hi1134) and revealed the distinct roles for sox9a and sox9b in development of crest, otic placode, cartilage and bone.
RelatedPubMedArticles Chiang, E. F.; Pai, C. I.; Wyatt, M.; Yan, Y. L.; Postlethwait, J.; Chung, B.: Two sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev Biol. 2001 Mar 1;231(1):149-63. PMID:11180959 Li, M.; Zhao, C.; Wang, Y.; Zhao, Z.; Meng, A.: Zebrafish sox9b is an early neural crest marker. Dev Genes Evol. 2002 May;212(4):203-6. Epub 2002 Apr 18. PMID:12012235 Yan, Y. L.; Miller, C. T.; Nissen, R. M.; Singer, A.; Liu, D.; Kirn, A.; Draper, B.; Willoughby, J.; Morcos, P. A.; Amsterdam, A.; Chung, B. C.; Westerfield, M.; Haffter, P.; Hopkins, N.; Kimmel, C.; Postlethwait, J. H.: A zebrafish sox9 gene required for cartilage morphogenesis. Development. 2002 Nov;129(21):5065-79. PMID:12397114 Yan, Y. L.; Willoughby, J.; Liu, D.; Crump, J. G.; Wilson, C.; Miller, C. T.; Singer, A.; Kimmel, C.; Westerfield, M.; Postlethwait, J. H.: A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development. Development. 2005 Mar;132(5):1069-83. Epub 2005 Feb 2. PMID:15689370 Rodríguez-Marí, A.; Yan, Y. L.; Bremiller, R. A.; Wilson, C.; Cañestro, C.; Postlethwait, J. H.: Characterization and expression pattern of zebrafish Anti-Müllerian hormone (Amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr Patterns. 2005 Jun;5(5):655-67. Epub 2005 Apr 19. PMID:15939378 Rau, M. J.; Fischer, S.; Neumann, C. J.: Zebrafish Trap230/Med12 is required as a coactivator for Sox9-dependent neural crest, cartilage and ear development. Dev Biol. 2006 Aug 1;296(1):83-93. Epub 2006 Apr 21. PMID:16712834 Xiong, K. M.; Peterson, R. E.; Heideman, W.: Aryl hydrocarbon receptor-mediated down-regulation of sox9b causes jaw malformation in zebrafish embryos Mol Pharmacol. 2008 Dec; 74(6):1544-53. Epub 2008 Sep 10. PMID:18784347 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-22 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort