Tags:
create new tag
, view all tags

slit3

slit (Drosophila) homolog 3

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName slit3
Aliases ENSDARG:ENSDARG00000034268; zgc:111911
Description slit (Drosophila) homolog 3
GenomicLocation chromosome 14 25491482-25760825 reverse strand
ExternalIDs Entrez:80354; EMBL:BC093131; UniGene:111170; ZFIN:ZDB-GENE-010306-4;
TranscriptID ENSDART:ENSDART00000146299; ENSDART:ENSDART00000046112; ENSDART:ENSDART00000126199
mRNA NCBI:NM_131736
GeneDescription Slit gene are known to play important roles in positioning of glial cells and commissures in the forebrain.
GeneFunction Barresi et al. (2005) had shown that Hh signaling is required for commissure formation, glial bridge formation and the restricted expression of the guidance molecules slit1a, slit2 and slit3 as well as sema3d. Expression studies of Slit2/3 were conducted during commissure formation and it was found that Slit2 and slit3 were shown to be expressed adjacent to the commissures, with the expression being absent from the regions where commissural axons and glial bridges cross the midline. It was further observed that in the yot mutants (gli2) slit2 and slit3 were expanded, with expression filling the commissural regions that were normally devoid of slit2/3 expression. Further morpholino antisense oligonucleotide were injected to reduce Slit function in wild-type and mutant embryos. It was demonstrated that inhibiton of slit2, slit3 or both slit2/3 in wild type embryos resulted in the defasciculation of the postoptic commissure, with many distinct axon bundles crossing, throughout the pre- and post-optic areas, Slit3/slit2 MO injections also caused some postoptic commissure axons to wander into inappropriate regions of the forebrain in most embryos. Further assay analysis of post-optic commissure formation in yot mutant injected with slit MO showed that slit2 and slit3 single MO injections partially rescued postoptic commissure formation in yot mutants whereas injection of both MOs rescued POC formation to a very significant level. It was also found that loss of slit2, slit3 or both led to anteroposterior spreading of Gfap+ cells in the pre- and post optic areas.
GeneCloning [BAC] CH211-51H20 and [BAC] CH211-245I19
GeneStructure This gene encodes 3 transcripts. (ENSDART00000146299) contains 36 exons and is 6,146 bps in length. The protein product (ENSDARP00000112770) consist of 1,516 residues. (ENSDART00000046112) contains 36 exons and is 6,135 bps in length. The protein product (ENSDARP00000046111) consist of 1,515 residues. (ENSDART00000126199) contains 6 exons and is 1244 bps in length. The protein product (ENSDARP00000111710) consist of 177 residues.
Protein ENSDARP00000112770 ENSDARP00000046111 ENSDARP00000111710
ProteinDomainandFamilies InterPro:IPR000152; InterPro:IPR000372; InterPro:IPR000483; InterPro:IPR000742; InterPro:IPR001611; InterPro:IPR001791; InterPro:IPR001881; InterPro:IPR003591; InterPro:IPR003645; InterPro:IPR006207; InterPro:IPR008985; InterPro:IPR013032; InterPro:IPR013320; InterPro:IPR018097; InterPro:IPR025875; InterPro:IPR026906;
Motifs Prosite:PS00010; Prosite:PS00022; Prosite:PS01185; Prosite:PS01186; Prosite:PS01187; Prosite:PS01225; Prosite:PS50025; Prosite:PS50026; Prosite:PS51450; PFAM:PF00008; PFAM:PF00560; Pfam:PF01462; Pfam:PF01463; Pfam:PF02210; Pfam:PF12661; Pfam:PF12799; Pfam:PF13306; UniProtKB:F1RCV3;
Expression ArrayExpress:ENSDARG00000034268;
GeneOntology GO:0007411; GO:0030517; GO:0005515; GO:0005509;
Orthologs Entrez:6586;
VariationAndRepeats RSID:rs40693427; RSID:rs40832517; RSID:rs41165231; RSID:rs40785518; RSID:rs41006392; RSID:rs41006392; RSID:rs41155587; RSID:rs41131047; RSID:rs41216239; RSID:rs40689395; RSID:rs41003682; RSID:rs40877292; RSID:rs41121418; RSID:rs41063904; RSID:rs41216471; RSID:rs40977830; RSID:rs41013654; RSID:rs41059297; RSID:rs40890975; RSID:rs40936850; RSID:rs40840397; RSID:rs41062091; RSID:rs40840848; RSID:rs40963811; RSID:rs40879938; RSID:rs179971783; RSID:rs41180388; RSID:rs40929287; RSID:rs40851912; RSID:rs40792844; RSID:rs41173480; RSID:rs41141704; RSID:rs40747400; RSID:rs40860741; RSID:rs41135255; RSID:rs40702248; RSID:rs40987483; RSID:rs40774887; RSID:rs41102186; RSID:rs40717632; RSID:rs40859750; RSID:rs40944810; RSID:rs41220463; RSID:rs41047244; RSID:rs40825739; RSID:rs40936824; RSID:rs179971991; RSID:rs179971751; RSID:rs179971887; RSID:rs179971868; RSID:rs179971948; RSID:rs179971689; RSID:rs179971759; RSID:rs179971791; RSID:rs179971913; RSID:rs179971647; RSID:rs40946311; RSID:rs40769433; RSID:rs41015447; RSID:rs41154653; RSID:rs40833157; RSID:rs40927596; RSID:rs40709964; RSID:rs40782835; RSID:rs41003607; RSID:rs40810255; RSID:rs40972945; RSID:rs41141443; RSID:rs40863524; RSID:rs179971806; RSID:rs41106145; RSID:rs40848650; RSID:rs40918337; RSID:rs41206352; RSID:rs40985187; RSID:rs41158226; RSID:rs40753403; RSID:rs41145604; RSID:rs40836262; RSID:rs41021596; RSID:rs41154482; RSID:rs40748729; RSID:rs40711972; RSID:rs41033206; RSID:rs41149675; RSID:rs40691260; RSID:rs40690080; RSID:rs40797221; RSID:rs40960453; RSID:rs40966917; RSID:rs40815058; RSID:rs41035790; RSID:rs41155543; RSID:rs40958952; RSID:rs41111576; RSID:rs40779563; RSID:rs40994399; RSID:rs40941010; RSID:rs40682943; RSID:rs41196518; RSID:rs40742694; RSID:rs41054707; RSID:rs40707287; RSID:rs40749005; RSID:rs40788962; RSID:rs40977482; RSID:rs41180410; RSID:rs41006876; RSID:rs41079635; RSID:rs40750101; RSID:rs40913663; RSID:rs40998133; RSID:rs41119806; RSID:rs40869258; RSID:rs40692406; RSID:rs40874448; RSID:rs41146474; RSID:rs41243918; RSID:rs40947647; RSID:rs40978986; RSID:rs41027965; RSID:rs41123687; RSID:rs41221473; RSID:rs41014168; RSID:rs41116947; RSID:rs41182992; RSID:rs40940987; RSID:rs41069269; RSID:rs41074386; RSID:rs40770394; RSID:rs41150574; RSID:rs41088415; RSID:rs40709000; RSID:rs41240959; RSID:rs41251065; RSID:rs41207536; RSID:rs40743932; RSID:rs40919720; RSID:rs40976260; RSID:rs40692883; RSID:rs40809098; RSID:rs41198816; RSID:rs40851374; RSID:rs41156006; RSID:rs40783592; RSID:rs40881694; RSID:rs41195259; RSID:rs41203469; RSID:rs40829733; RSID:rs40755140; RSID:rs41021979; RSID:rs41049722; RSID:rs41208261; RSID:rs40761264; RSID:rs40848194; RSID:rs40911182; RSID:rs40696258; RSID:rs41009392; RSID:rs40934222; RSID:rs41018765; RSID:rs40687605; RSID:rs40902456; RSID:rs41035818; RSID:rs40738055; RSID:rs40975927; RSID:rs41036361; RSID:rs40822882; RSID:rs179971809; RSID:rs179971962; RSID:rs179971646; RSID:rs179971896; RSID:rs40788720; RSID:rs40670989; RSID:rs41092855; RSID:rs40858877; RSID:rs40776541; RSID:rs41047630; RSID:rs41191785; RSID:rs41039548; RSID:rs40684924; RSID:rs41049654; RSID:rs40819332; RSID:rs41183013; RSID:rs40810979; RSID:rs40980918; RSID:rs40936114; RSID:rs41160764; RSID:rs40780372; RSID:rs40853703; RSID:rs40967736; RSID:rs40756343; RSID:rs41056249; RSID:rs40988085; RSID:rs40925935; RSID:rs179971918; RSID:rs179971650; RSID:rs179971802; RSID:rs179971730; RSID:rs179971737; RSID:rs179971690; RSID:rs179971919; RSID:rs179971904; RSID:rs179971884; RSID:rs41242012; RSID:rs41098026; RSID:rs41048073; RSID:rs41153276; RSID:rs41161996; RSID:rs41128209; RSID:rs179971830; RSID:rs40908190; RSID:rs40695438; RSID:rs40871071; RSID:rs41187796; RSID:rs40855578; RSID:rs40962724; RSID:rs40787923; RSID:rs40799515; RSID:rs40913376; RSID:rs41030383; RSID:rs40920953; RSID:rs41208734; RSID:rs40921191; RSID:rs40664408; RSID:rs179971975; RSID:rs41075469; RSID:rs40886169; RSID:rs179971735; RSID:rs179971683; RSID:rs40753830; RSID:rs40871330; RSID:rs40767744; RSID:rs40686222; RSID:rs40857246; RSID:rs179971935; RSID:rs179971875; RSID:rs179971932; RSID:rs179971851; RSID:rs179971686; RSID:rs179971916; RSID:rs179971703; RSID:rs179971734; RSID:rs179971769; RSID:rs179971776; RSID:rs179971621; RSID:rs179971943; RSID:rs179971630; RSID:rs179971808; RSID:rs179971860; RSID:rs40967636; RSID:rs41102293; RSID:rs179971792; RSID:rs179971738; RSID:rs179971774; RSID:rs179971795; RSID:rs40925198; RSID:rs41039196; RSID:rs41172164; RSID:rs179971993; RSID:rs179971684; RSID:rs41044251; RSID:rs41086635; RSID:rs41035385; RSID:rs40986613; RSID:rs41218324; RSID:rs40874340; RSID:rs179971777; RSID:rs41008928; RSID:rs179971994; RSID:rs179971760; RSID:rs179971633; RSID:rs41093550; RSID:rs41087535; RSID:rs41002645; RSID:rs41216746; RSID:rs41142531; RSID:rs40849731; RSID:rs40684832; RSID:rs41156212; RSID:rs40778719; RSID:rs179971955; RSID:rs179971723; RSID:rs179971831; RSID:rs179971725; RSID:rs179971976; RSID:rs179971862; RSID:rs41030700; RSID:rs40980189; RSID:rs179971902; RSID:rs179971883; RSID:rs179971920; RSID:rs179971711; RSID:rs179971832; RSID:rs179971750; RSID:rs40857066; RSID:rs40946718; RSID:rs40953180; RSID:rs40771198; RSID:rs179971698; RSID:rs179971784; RSID:rs179971818; RSID:rs179971849; RSID:rs179971857; RSID:rs179971706; RSID:rs179971838; RSID:rs179971931; RSID:rs179971622; RSID:rs179971967; RSID:rs179971906; RSID:rs40824089; RSID:rs40747675; RSID:rs40984382; RSID:rs40775595; RSID:rs40915619; RSID:rs41103047; RSID:rs41116240; RSID:rs41079433; RSID:rs41230622; RSID:rs40828880; RSID:rs41156777; RSID:rs40781340; RSID:rs41194926; RSID:rs40624259; RSID:rs40886568; RSID:rs41204312; RSID:rs41136001; RSID:rs41096125; RSID:rs40690182; RSID:rs40966366; RSID:rs41034403; RSID:rs40934533; RSID:rs41205910; RSID:rs40727325; RSID:rs41152644; RSID:rs41174516; RSID:rs40838162; RSID:rs41162587; RSID:rs41006874; RSID:rs41064882; RSID:rs179971614; RSID:rs179971642; RSID:rs179971819; RSID:rs179971655; RSID:rs179971937; RSID:rs179971720; RSID:rs179971804; RSID:rs179971736; RSID:rs179971677; RSID:rs179971697; RSID:rs179971826; RSID:rs179971939; RSID:rs40685764; RSID:rs40893061; RSID:rs41021711; RSID:rs41187322; RSID:rs41240244; RSID:rs41110081; RSID:rs41160543; RSID:rs40842996; RSID:rs41251387; RSID:rs40964819; RSID:rs41178323; RSID:rs41137077; RSID:rs179971803; RSID:rs179971610; RSID:rs179971801; RSID:rs179971693; RSID:rs179971765; RSID:rs179971745; RSID:rs179971929; RSID:rs179971641; RSID:rs179971815; RSID:rs179971611; RSID:rs40924489; RSID:rs179971680; RSID:rs179971878; RSID:rs179971661; RSID:rs179971729; RSID:rs179971618; RSID:rs40721753; RSID:rs41130837; RSID:rs41241156; RSID:rs40816303; RSID:rs41009802; RSID:rs41034711; RSID:rs40828071; RSID:rs41222230; RSID:rs40986167; RSID:rs41112213; RSID:rs40713798; RSID:rs41121866; RSID:rs179971789; RSID:rs41020588; RSID:rs40749788; RSID:rs41226290; RSID:rs41145942; RSID:rs41028758; RSID:rs41013841; RSID:rs41159259; RSID:rs179971764; RSID:rs179971740; RSID:rs179971712; RSID:rs179971695; RSID:rs179971923; RSID:rs179971704; RSID:rs179971837; RSID:rs179971992; RSID:rs179971870; RSID:rs179971984; RSID:rs179971873; RSID:rs179971658; RSID:rs179971854; RSID:rs179971718; RSID:rs179971861; RSID:rs179971983; RSID:rs179971961; RSID:rs179971696; RSID:rs179971924; RSID:rs179971705; RSID:rs179971733; RSID:rs41068634; RSID:rs41008578; RSID:rs40956509; RSID:rs41216762; RSID:rs41003437; RSID:rs40921940; RSID:rs40981153; RSID:rs40790025; RSID:rs40944801; RSID:rs40630936; RSID:rs41184463; RSID:rs40940567; RSID:rs40705640; RSID:rs41189159; RSID:rs40729144; RSID:rs40681315; RSID:rs40886420; RSID:rs40871738; RSID:rs179971816; RSID:rs179971772; RSID:rs179971719; RSID:rs179971648; RSID:rs179971990; RSID:rs179971881; RSID:rs179971858; RSID:rs41232474; RSID:rs179971944; RSID:rs41157484; RSID:rs41240828; RSID:rs179971707; RSID:rs179971835; RSID:rs179971668; RSID:rs179971746; RSID:rs179971793; RSID:rs179971721; RSID:rs179971800; RSID:rs179971628; RSID:rs179971811; RSID:rs179971652; RSID:rs179971928; RSID:rs179971612; RSID:rs179971888; RSID:rs179971716; RSID:rs40792801; RSID:rs41182885; RSID:rs40682040; RSID:rs40691993; RSID:rs40691993; RSID:rs179971911; RSID:rs179971659; RSID:rs40905871; RSID:rs40698714; RSID:rs40791107; RSID:rs40896076; RSID:rs41206294; RSID:rs41168644; RSID:rs41099495; RSID:rs41132331; RSID:rs179971778; RSID:rs179971798; RSID:rs40836074; RSID:rs40976057; RSID:rs41077557; RSID:rs41115431; RSID:rs41080365; RSID:rs40825661; RSID:rs41076809; RSID:rs40883492; RSID:rs41144046; RSID:rs41005336; RSID:rs40921689; RSID:rs179971848; RSID:rs179971859; RSID:rs179971995; RSID:rs40967127; RSID:rs40936589; RSID:rs40931583; RSID:rs41072138; RSID:rs40699375; RSID:rs40971078; RSID:rs41060556; RSID:rs40798934; RSID:rs179971727; RSID:rs40742042; RSID:rs40815990; RSID:rs179971805; RSID:rs40780001; RSID:rs40847151; RSID:rs41248915; RSID:rs41131024; RSID:rs179971616; RSID:rs179971940; RSID:rs179971880; RSID:rs40738594; RSID:rs41212300; RSID:rs41082700; RSID:rs41184682; RSID:rs41110497; RSID:rs41072142; RSID:rs41054168; RSID:rs40896460; RSID:rs40882303; RSID:rs40731305; RSID:rs40696783; RSID:rs40969660; RSID:rs41239897; RSID:rs40861395; RSID:rs179971898; RSID:rs179971970; RSID:rs179971938; RSID:rs179971619; RSID:rs179971846; RSID:rs179971637; RSID:rs179971956; RSID:rs179971892; RSID:rs179971879; RSID:rs179971947; RSID:rs179971613; RSID:rs179971941; RSID:rs179971631; RSID:rs179971728; RSID:rs40998141; RSID:rs179971907; RSID:rs179971701; RSID:rs179971825; RSID:rs179971663; RSID:rs179971981; RSID:rs179971876; RSID:rs179971979; RSID:rs179971963; RSID:rs179971682; RSID:rs179971922; RSID:rs179971709; RSID:rs179971732; RSID:rs179971767; RSID:rs179971747; RSID:rs179971794; RSID:rs179971617; RSID:rs179971942; RSID:rs179971629; RSID:rs179971672; RSID:rs179971894; RSID:rs179971968; RSID:rs179971949; RSID:rs179971895; RSID:rs40768858; RSID:rs40744104; RSID:rs179971959; RSID:rs179971790; RSID:rs179971945; RSID:rs179971636; RSID:rs179971986; RSID:rs179971971; RSID:rs179971863; RSID:rs179971891; RSID:rs41072994; RSID:rs40942686; RSID:rs40707441; RSID:rs40839973; RSID:rs40923382; RSID:rs40806636; RSID:rs40799907; RSID:rs40928168; RSID:rs41048356; RSID:rs40763118; RSID:rs40891722; RSID:rs40721378; RSID:rs40974705; RSID:rs41194042; RSID:rs41032024; RSID:rs40779141; RSID:rs179971821; RSID:rs40856075; RSID:rs40878817; RSID:rs41194872; RSID:rs40885795; RSID:rs40860411; RSID:rs40704786; RSID:rs40778662; RSID:rs40728199; RSID:rs40895915; RSID:rs41065705; RSID:rs41104749; RSID:rs41244251; RSID:rs41170267; RSID:rs41138157; RSID:rs41013996; RSID:rs179971748; RSID:rs179971780; RSID:rs41110012; RSID:rs41147513; RSID:rs179971626; RSID:rs179971889; RSID:rs179971844; RSID:rs179971692; RSID:rs179971755; RSID:rs179971787; RSID:rs179971722; RSID:rs179971852; RSID:rs179971634; RSID:rs179971908; RSID:rs179971651; RSID:rs179971828; RSID:rs179971951; RSID:rs179971627; RSID:rs179971812; RSID:rs179971643; RSID:rs40785085; RSID:rs40730348; RSID:rs40920537; RSID:rs40796068; RSID:rs40976144; RSID:rs41140238; RSID:rs40967484; RSID:rs41151448; RSID:rs40926920; RSID:rs40913365; RSID:rs41189060; RSID:rs40817552; RSID:rs40947815; RSID:rs40919791; RSID:rs179971840; RSID:rs179971674; RSID:rs179971973; RSID:rs179971865; RSID:rs179971782; RSID:rs40897511; RSID:rs179971639; RSID:rs179971615; RSID:rs179971980; RSID:rs179971867; RSID:rs179971638; RSID:rs179971914; RSID:rs179971657; RSID:rs179971788; RSID:rs40857995; RSID:rs41100016; RSID:rs41131822; RSID:rs41164891; RSID:rs41064685; RSID:rs40925476; RSID:rs41028232; RSID:rs41091205; RSID:rs40765498; RSID:rs179971694; RSID:rs179971874; RSID:rs179971673; RSID:rs40696085; RSID:rs40923286; RSID:rs41039803; RSID:rs40772767; RSID:rs40881391; RSID:rs40997665; RSID:rs41089542; RSID:rs40709818; RSID:rs179971974; RSID:rs40867781; RSID:rs179971960; RSID:rs41221241; RSID:rs41103909; RSID:rs40971458; RSID:rs40836582; RSID:rs40749805; RSID:rs41077999; RSID:rs40685106; RSID:rs41051960; RSID:rs40836067; RSID:rs41009137; RSID:rs41140190; RSID:rs41031557; RSID:rs179971834; RSID:rs179971670; RSID:rs40965087; RSID:rs40755445; RSID:rs41170165; RSID:rs40809263; RSID:rs41127115; RSID:rs41031698; RSID:rs40838387; RSID:rs40898728; RSID:rs40966225; RSID:rs40932711; RSID:rs40916300; RSID:rs41016438; RSID:rs40817141; RSID:rs41081921; RSID:rs41187668; RSID:rs40799979; RSID:rs41148786; RSID:rs179971662; RSID:rs40746690; RSID:rs41006021; RSID:rs41027221; RSID:rs40856626; RSID:rs40679749; RSID:rs41171440; RSID:rs41156735; RSID:rs40709260; RSID:rs40795259; RSID:rs41100739; RSID:rs41063749; RSID:rs41103101; RSID:rs41236314; RSID:rs179971763; RSID:rs179971807; RSID:rs179971903; RSID:rs179971886; RSID:rs179971964; RSID:rs179971996; RSID:rs179971829; RSID:rs40688630; RSID:rs41010338; RSID:rs40909937; RSID:rs41148038; RSID:rs40958550; RSID:rs41225392; RSID:rs40961291; RSID:rs40664783; RSID:rs40842423; RSID:rs41217848; RSID:rs41113561; RSID:rs40835140; RSID:rs179971731; RSID:rs179971645; RSID:rs179971660; RSID:rs179971620; RSID:rs179971847; RSID:rs179971768; RSID:rs179971744; RSID:rs179971785; RSID:rs179971824; RSID:rs179971665; RSID:rs179971982; RSID:rs179971869; RSID:rs179971856; RSID:rs179971985; RSID:rs179971675; RSID:rs179971850; RSID:rs179971681; RSID:rs179971925; RSID:rs40883720; RSID:rs179971756; RSID:rs179971691; RSID:rs179971773; RSID:rs179971753; RSID:rs40896350; RSID:rs40827129; RSID:rs40937183; RSID:rs179971741; RSID:rs179971864; RSID:rs179971897; RSID:rs179971957; RSID:rs179971915; RSID:rs179971702; RSID:rs40922079; RSID:rs179971700; RSID:rs179971927; RSID:rs179971972; RSID:rs179971624; RSID:rs41211046; RSID:rs179971946; RSID:rs179971708; RSID:rs179971987; RSID:rs40976213; RSID:rs179971966; RSID:rs179971900; RSID:rs41097884; RSID:rs41111035; RSID:rs179971936; RSID:rs179971669; RSID:rs179971699; RSID:rs179971988; RSID:rs179971885; RSID:rs41236078; RSID:rs41210673; RSID:rs40749881; RSID:rs41076158; RSID:rs40786196; RSID:rs40848160; RSID:rs40834002; RSID:rs40898311; RSID:rs41231945; RSID:rs179971872; RSID:rs179971901; RSID:rs179971853; RSID:rs179971635; RSID:rs179971909; RSID:rs179971717; RSID:rs179971799; RSID:rs179971671; RSID:rs179971786; RSID:rs179971713; RSID:rs179971797; RSID:rs179971679; RSID:rs179971667; RSID:rs40905175; RSID:rs40929749; RSID:rs40733688; RSID:rs40635039; RSID:rs40934740; RSID:rs40603809; RSID:rs40922989; RSID:rs40716749; RSID:rs40667597; RSID:rs40839571; RSID:rs40824237; RSID:rs41114384; RSID:rs40785961; RSID:rs40897495; RSID:rs40962592; RSID:rs41119745; RSID:rs40716004; RSID:rs40745309; RSID:rs40825614; RSID:rs40894581; RSID:rs41041250; RSID:rs41187553; RSID:rs41238856; RSID:rs40941800; RSID:rs40784385; RSID:rs41191788; RSID:rs40971197; RSID:rs40849400; RSID:rs41219541; RSID:rs40682710; RSID:rs41076286; RSID:rs41148690; RSID:rs41042909; RSID:rs41091869; RSID:rs40748835; RSID:rs41167894; RSID:rs40759406; RSID:rs40962592; RSID:rs41119745; RSID:rs40716004; RSID:rs40745309; RSID:rs40825614; RSID:rs40894581; RSID:rs41041250; RSID:rs41187553; RSID:rs41238856; RSID:rs40941800; RSID:rs40784385; RSID:rs41191788; RSID:rs40971197; RSID:rs40849400; RSID:rs41219541; RSID:rs40682710; RSID:rs41076286; RSID:rs40748835; RSID:rs41167894; RSID:rs40759406; RSID:rs41139674; RSID:rs41172885; RSID:rs179971933; RSID:rs41044738; RSID:rs41149261; RSID:rs179971843; RSID:rs41194679; RSID:rs179971953; RSID:rs179971893; RSID:rs179971882; RSID:rs41158658; RSID:rs40804506; RSID:rs40736065; RSID:rs179971917; RSID:rs179971656; RSID:rs40883858; RSID:rs179971781; RSID:rs179971965; RSID:rs179971810; RSID:rs41018639; RSID:rs41199291; RSID:rs179971771; RSID:rs179971877; RSID:rs179971977; RSID:rs179971989; RSID:rs179971687; RSID:rs41205546; RSID:rs179971758; RSID:rs179971823; RSID:rs179971813; RSID:rs41200367; RSID:rs179971842; RSID:rs41068344; RSID:rs41003245; RSID:rs40924058; RSID:rs179971678; RSID:rs40900297; RSID:rs179971969; RSID:rs41243868; RSID:rs179971743; RSID:rs179971839; RSID:rs179971654; RSID:rs40990069
DisordersAndMutations Morpholino MO1-slit3 (5' - TATATCCTCTGAGGCTGATAGCAGC - 3') was used against slit3 to study its effect on the zebrafish embryos.
RelatedPubMedArticles Barresi, M. J. F.; Hutson, L. D.; Chien, C.; Karlstrom, R. O.: Hedgehog regulated slit expression determines commissure and glial cell position in the zebrafish forebrain. Development 132, 3643-3656, 2005. PMID:16033800 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-22 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort