Tags:
create new tag
, view all tags

robo3

roundabout homolog 3

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName robo3
Aliases ENSDARG:ENSDARG00000005645; cb503
Description roundabout homolog 3
GenomicLocation chromosome 10 32312906-32518450 reverse strand
ExternalIDs EMBL:AF337036; Entrez:30770;UniGene:77473; ZFIN:ZDB-GENE-000209-4;
TranscriptID ENSDART:ENSDART00000024778; ENSDART:ENSDART00000023575
mRNA NCBI:NM_131482
GeneDescription Robo3 is a member of immunoglobulin gene superfamily which encodes for an integral membrane protein. It is both an axon guidance receptor as well as a cell adhesion receptor. This receptor is involved in the decision by the axon to cross Central nervous system midline.
GeneFunction Challa et al. (2001) identified and characterized two robo family members from zebrafish. They were named as robo3 and robo1. They further showed that both are expressed dynamically in the developing nervous system in different patterns. They reported that robo1 nervous system expression appears later in development and is restricted.Challa et al, (2005) reported the two alternately spliced isoforms for Robo3. Robo3a knock-down (using morpholinos) resulted in dorsalized phenotypes that appear to be a result of defective gastrulation. Robo3b knock-down resulted in motor axon pathfinding defects.Devine te al. (2008) identified the role for Robo family for axon guidance receptors in the proper positioning of longitudinally projecting axons along the dorsoventral axis in the embryonic zebrafish forebrain.They further established that Robo family members exhibited complementary functions in the tract of the post-optic commissure. Robo3 along with Robo1 restricted the extent of defasciculation of the TPOC. They also showed that the knockdown of Robo1 using morpholinos caused the abnormal spreading of longitudinal axon tracts in the forebrain.
GeneCloning robo3 Contained in [BAC] DKEY-30J19, DKEY-77G18, DKEY-119J14
GeneStructure The transcript ENSDART00000023575 consist of 27 exons and is 5,056 bps in length. The protein product (ENSDARP00000027377) consist of 1,419 residues. The transcript ENSDART00000024778 consist of 27 exons and is 5344 bps in length. The protein product (ENSDARP00000003540) consist of 1,389 residues.
Protein ENSDARP:ENSDARP00000003540; ENSDARP:ENSDARP00000027377;
ProteinDomainandFamilies InterPro:IPR003598; InterPro:IPR003961; InterPro:IPR007110; InterPro:IPR013098; InterPro:IPR013783;
Motifs Prosite:PS50835; Prosite:PS50853; PFAM:PF00041; PFAM:PF07679; UniProtKB:Q98SW3;
Expression ArrayExpress:ENSDARG00000005645;
GeneOntology GO:0005887; GO:0016021; GO:0048676; GO:0048264; GO:0004872;
Orthologs Entrez:64221;
VariationAndRepeats RSID:rs40990761; RSID:rs41136737; RSID:rs180133092; RSID:rs41070550; RSID:rs40840735; RSID:rs40866363; RSID:rs180133093; RSID:rs180133094; RSID:rs180133096; RSID:rs41200035; RSID:rs180133097; RSID:rs40939119; RSID:rs40739218; RSID:rs180133098; RSID:rs40726765; RSID:rs41252323; RSID:rs180133099; RSID:rs180133100; RSID:rs180133102; RSID:rs180133103; RSID:rs180133104; RSID:rs41105967; RSID:rs40713101; RSID:rs41128582; RSID:rs180133105; RSID:rs180133106; RSID:rs180133107; RSID:rs41223710; RSID:rs180133108; RSID:rs40826778; RSID:rs41119653; RSID:rs40824911; RSID:rs40973693; RSID:rs40739037; RSID:rs40829662; RSID:rs41004238; RSID:rs40694139; RSID:rs41206047; RSID:rs40803727; RSID:rs40979382; RSID:rs40912840; RSID:rs40921658; RSID:rs180133109; RSID:rs180133110; RSID:rs180133111; RSID:rs180133112; RSID:rs180133114; RSID:rs180133115; RSID:rs180133116; RSID:rs180133117; RSID:rs180133118; RSID:rs180133119; RSID:rs180133120; RSID:rs180133121; RSID:rs180133122; RSID:rs40736368; RSID:rs180133123; RSID:rs180133124; RSID:rs180133125; RSID:rs180133126; RSID:rs180133127; RSID:rs180133128; RSID:rs180133129; RSID:rs180133130; RSID:rs180133132; RSID:rs180133133; RSID:rs180133135; RSID:rs180133136; RSID:rs180133138; RSID:rs180133139; RSID:rs40919924; RSID:rs180133140; RSID:rs180133092; RSID:rs41070550; RSID:rs40840735; RSID:rs40866363; RSID:rs180133093; RSID:rs180133094; RSID:rs180133096; RSID:rs41200035; RSID:rs180133097; RSID:rs40939119; RSID:rs40739218; RSID:rs180133098; RSID:rs40726765; RSID:rs41252323; RSID:rs180133099; RSID:rs180133100; RSID:rs180133102; RSID:rs180133103; RSID:rs180133104; RSID:rs41105967; RSID:rs40713101; RSID:rs41128582; RSID:rs180133105; RSID:rs180133106; RSID:rs180133107; RSID:rs41223710; RSID:rs180133108; RSID:rs40826778; RSID:rs41119653; RSID:rs40824911; RSID:rs40973693; RSID:rs40739037; RSID:rs40829662; RSID:rs41004238; RSID:rs40694139; RSID:rs41206047; RSID:rs40803727; RSID:rs40979382; RSID:rs40912840; RSID:rs40921658; RSID:rs180133109; RSID:rs180133110; RSID:rs180133111; RSID:rs180133112; RSID:rs180133114; RSID:rs180133115; RSID:rs180133116; RSID:rs180133117; RSID:rs180133118; RSID:rs180133119; RSID:rs180133120; RSID:rs180133121; RSID:rs180133122; RSID:rs40736368; RSID:rs180133123; RSID:rs180133124; RSID:rs41126668
DisordersAndMutations ZFINID:ZDB-GENO-110803-3;ZFINID:ZDB-GENO-980202-1514;ZFINID:ZDB-GENO-100729-4;ZFINID:ZDB-GENO-980202-1088;ZFINID:ZDB-GENO-100729-5;ZFINID:ZDB-GENO-980202;Morpholinos MO1-robo3 (5'-CCCTAAAAGCGCTACAATCCACCTG-3'), MO2-robo3( 5'- CTCTTCTTTAGCAGCGGAGGGGACG-3'),MO3-robo3(5'-GCATCCAAAGTCCTGCGAAACTCCA-3'),MO4-robo3 (5'AAAGTCCACCTCAGTCGCCTTTATC3')andMO5-robo3(5' TCTTTATCAGGTAACGCAGCATCTC3') had been used against Robo1.
RelatedPubMedArticles Challa AK, Beattie CE, Seeger MA Identification and characterization of roundabout orthologs in zebrafish. Mech Dev. 2001 Mar;101(1-2):249-53. PMID:11231085 Devine CA, Key B. Robo-Slit interactions regulate longitudinal axon pathfinding in the embryonic vertebrate brain. Dev Biol. 2008 Jan 1;313(1):371-83. PMID:18061159 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r5 - 2013-09-03 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort