Tags:
create new tag
, view all tags

Robo1

roundabout homolog 1

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName Robo1
Aliases ENSDARG:ENSDARG00000026784
Description roundabout homolog 1
GenomicLocation chromosome 15 37504917-37792411 forward strand
ExternalIDs EMBL:BC163550; Entrez:30769; ZFIN:ZDB-GENE-000209-3; UniGene:11719
TranscriptID ENSDART:ENSDART00000097133; ENSDART:ENSDART00000076098; ENSDART:ENSDART00000034683; ENSDART:ENSDART00000126856; ENSDART:ENSDART00000097134
mRNA NCBI:NM_131481
GeneDescription Robo1 is a member of immunogflobulin gene superfamily which encodes for an integral memebrane protein. It is both an axon guidance receptor as well as a cell adhesion receptor. This receptor is involved in the decision by the axon to cross Central nervous system midline.
GeneFunction Challa et al., 2001 had identified and characterized two robo family member from zebrafish. They were named as robo1 and robo3. They had further shown that both are expressed dynamically in the developing nervous system in different patterns. They had reported that robo1 nervous system expression appears later in development and is restricted. Devine te al., 2008 identified the role for Robo family for axon guidance receptors in the proper positioning of longitudinally projecting axons along the dorsoventral axis in the embryonic zebrafish forebrain.They had further established that Robo family members exhibited complementary functions in the tract of the post-optic commissure. Robo1 along with Robo3 restricted the extent of defasciculation of the TPOC. They had also shown that the knockdown of Robo1 using morpholinos caused the abnormal spreading of longitudinal axon tracts in the forebrain.
GeneCloning This gene is contained in a clone MGC:195108 (Vector: pCR4-TOPO forward).
GeneStructure The gene encodes for 5 novel transcripts. The transcript ENSDART00000034683 consist of 29 exons and is 5004 bps in length. The protein product (ENSDARP00000038219) consist of 1,568 residues. The transcript ENSDART00000076098 consist of 33 exons and is 5073 bps in length. The protein product (ENSDARP00000070577) consist of 1591 residues. The transcript ENSDART00000126856 consist of 20 exons and is 2705 bps in length. The protein product (ENSDARP00000112419) consist of 839 residues. The transcript ENSDART00000097133 consist of 28 exons and is 5008 bps in length. The protein product (ENSDARP00000087906) consist of 1632 residues. The transcript ENSDART00000097134 consist of 29 exons and is 4,602 bps in length. The protein product (ENSDARP00000087907) consist of 1,533 residues.
Protein ENSDARP:ENSDARP00000087906; ENSDARP:ENSDARP00000070577; ENSDARP:ENSDARP00000038219; ENSDARP:ENSDARP00000112419; ENSDARP:ENSDARP00000087907;
ProteinDomainandFamilies InterPro:IPR003598; InterPro:IPR003961; InterPro:IPR007110; InterPro:IPR013098; InterPro:IPR013783;
Motifs Prosite:PS50835; Prosite:PS50853; PFAM:PF00041; PFAM:PF07679;
Expression ArrayExpress:ENSDARG00000026784
GeneOntology GO:0004872; GO:0007411; GO:0016021
Orthologs Entrez:6091;
VariationAndRepeats RSID:rs180107604; RSID:rs41150819; RSID:rs41117302; RSID:rs180107603; RSID:rs180107602; RSID:rs180107601; RSID:rs180107600; RSID:rs180107599; RSID:rs180107598; RSID:rs180107597; RSID:rs180107595; RSID:rs180107594; RSID:rs180107593; RSID:rs180107591; RSID:rs180107590; RSID:rs180107589; RSID:rs180107588; RSID:rs40921865; RSID:rs180107587; RSID:rs180107586; RSID:rs180107585; RSID:rs180107584; RSID:rs180107583; RSID:rs180107581; RSID:rs180107565; RSID:rs180107566; RSID:rs180107578; RSID:rs180107567; RSID:rs180107576; RSID:rs180107575; RSID:rs180107574; RSID:rs180107573; RSID:rs180107572; RSID:rs180107571; RSID:rs180107570; RSID:rs41235100; RSID:rs180107569; RSID:rs180107568; RSID:rs40647535; RSID:rs180107563; RSID:rs40835614; RSID:rs180107562; RSID:rs180107561; RSID:rs180107560; RSID:rs40708830; RSID:rs40883162; RSID:rs180107559; RSID:rs180107558; RSID:rs180107557; RSID:rs40998286; RSID:rs180107556; RSID:rs180107555; RSID:rs180107554; RSID:rs180107553
DisordersAndMutations Morpholinos MO1-robo1(5' - ATCCAATTATTCTCCCCGTCATCGT - 3') and MO2-robo1( 5' - CGCGTTTTAGATAGATGCTTGTGTA - 3') had been used against Robo1.
RelatedPubMedArticles Challa AK, Beattie CE, Seeger MA Identification and characterization of roundabout orthologs in zebrafish. Mech Dev. 2001 Mar;101(1-2):249-53. PMID:11231085 Devine CA, Key B. Robo-Slit interactions regulate longitudinal axon pathfinding in the embryonic vertebrate brain. Dev Biol. 2008 Jan 1;313(1):371-83. PMID:18061159 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r5 - 2013-09-03 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort