Tags:
create new tag
, view all tags

Ripply1

ripply1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName Ripply1
Aliases ENSDARG:ENSDARG00000054103;
Description ripply1
GenomicLocation chromosome 21 36930713-36937075 reverse strand
ExternalIDs EMBL:BC162410; ZFIN:ZDB-GENE-060113-1; Entrez:654446; UniGene:52821
TranscriptID ENSDART:ENSDART00000133405; ENSDART:ENSDART00000076247; ENSDART:ENSDART00000136080; ENSDART:ENSDART00000131490; ENSDART:ENSDART00000136569
mRNA NCBI:NM_001039108
GeneDescription Ripply1 plays dual roles in the transition from the PSM to somites. It terminates the segmentation program in the PSM and maintains rostrocaudal polarity.
GeneFunction Thisse et al, (2004), gave the complete expression pattern of rad17 gene in developing zebrafish. From 1 cell to pec-fin stage there is basal level expression of this gene in zebrafish embryo with more labelling in central nervous system, eye, blood.Kawamura et al. (2005) stated that ripply1 expressed in prisomitic mesoderm (PSM) and newly formed somites which encodes for nuclear protein is associated with Groucho co repressor. This complex of Groucho and nuclear protein is essential for the transition from the PSM to somite stage.The embryos which are deficient in ripply1 showed the non formation of somite boundaries and even the gene expression in PSM is not properly terminated. Rostrocaudal polarity in segments is also not maintained. Paraxial mesoderm cells become differentiated. Ripply1 is required for termination of gene expression or segmental patterning in PSM.Moreno et al. (2008) states that zebrafish embryo were treated with Retinoic Acid (RA) and CHX. CHX blocked the inhibitory properties of RA. Thus in Zebrafish RA repressed the PSM to somite transition.When ripply1 was surveyed for RA reponsiveness, it was observed that when treated with RA ripply1 expression was observed throughout the tailbud domain. Thus, RA induces the expression of ripply1 in presence of CHX.
GeneCloning ripply1 Contained in [BAC] DKEY-38K9
GeneStructure Ripply1 encodes four transcripts. ENSDART00000133405 which consists of 5 exon and 1253 bps. The protein product ENSDARP00000122894 consists of 140 aminoacids. ENSDART00000136569 which consists of 3 exon and 872 bps. The protein product ENSDARP00000114232 consists of 68 aminoacids. ENSDART00000076247 which consists of 4 exon and 849 bps. The protein product ENSDARP00000070724 consists of 140 aminoacids. ENSDART00000131490 which consists of 3 exon and 850 bps. There is no protein product. ENSDART00000136080 which consists of 3 exon and 823 bps. There is no protein product.
Protein ENSDARP:ENSDARP00000122894; ENSDARP:ENSDARP00000070724; ENSDARP:ENSDARP00000114232;
ProteinDomainandFamilies No data available
Motifs No data available
Expression ArrayExpress:ENSDARG00000054103;
GeneOntology GO:0005634; GO:0001757; GO:0009880;
Orthologs Entrez:92129;
VariationAndRepeats No data available
DisordersAndMutations Kawamura et al. (2005) showed that there are two morpholinos present for ripply1. First is MO1-ripply1 having the sequence 5' - CATCGTCACTGTGTTTTTCGTTTTG - 3'. The second morpholino is MO2-ripply1 having the sequence 5' - GCGCTGGTCGAGAATAGTCCGGCGG - 3'.
RelatedPubMedArticles Thisse, B., Pflumio, S., Fürthauer, M., Loppin, B., Heyer, V., Degrave, A., Woehl, R., Lux, A., Steffan, T., Charbonnier, X.Q. and Thisse, C. (2001) Expression of the zebrafish genome during embryogenesis (NIH R01 RR15402). ZFIN Direct Data Submission.Kawamura, A., Koshida, S., Hijikata, H., Ohbayashi, A., Kondoh, H., and Takada, S. (2005) Groucho-associated transcriptional repressor ripply1 is required for proper transition from the presomitic mesoderm to somites. Dev. Cell 9(6): 735-744. PMID:16326386 .Tanya A. Moreno, Roberto Jappelli, Juan Carlos Izpisúa Belmonte, Chris Kintner, (2008) Retinoic acid regulation of the Mesp–Ripply feedback loop during vertebrate segmental patterning.; Developmental Biology 315 317–330. PMID:18261720 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r5 - 2013-09-02 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort