Tags:
create new tag
, view all tags

rag1

recombination activating gene 1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName rag1
Aliases ENSDARG:ENSDARG00000052122; recombinase, etID309719.25, recombination activating gene 1
Description recombination activating gene 1
GenomicLocation chromosome 25 9231637-9238142 forward strand
ExternalIDs Entrez:30663; EMBL:U71093; UniGene:133607; ZFIN:ZDB-GENE-990415-234;
TranscriptID ENSDART:ENSDART00000142917; ENSDART:ENSDART00000073913
mRNA NCBI:NM_131389
GeneDescription Receptors of the adaptive immune system are encoded in genome as multiple segments: variable (V), diversity (D),joining (J) and constant (C). Functional genes are created by recombination of these gene segments generating a virtually unlimited variety of immune receptors. Recombination activating proteins encoded by RAG1 and RAG2 genes perform critical DNA recognition and cleavage functions in V(D)J recombination (Gellert, 2002)..
GeneFunction Feng et al 2005, documented that Rag1 expression is restricted to a subpopulation of zebrafish olfactory neurons projecting to the lateral olfactory bulb. RAG1 catalytic activity is not essential for axon targeting, nor is it likely to be required for regulation of odorant receptor expression or the response ofOSNs to amino acidsNadia Danilova 2005 describing that Recombination signal sequences (RSS) are recognized by RAG1 protein, which also has specific features in teleost suggesting co-evolution of RAG1 with corresponding RSS.Lam et al 2002, showed that Tissue section in situ hybridization (ISH) analysis with rag-1 probe reveals that cortex-medullaryregionalizationhas begun between 1 and 2 wpf as rag-1 expression clearly demarcated the cortex, whereas the medulla was rag-1 negative. The presence of TCRACpositive cells in the medulla by 23 wpf, suggests that the thymic selectionprocesses hadbegun. The zebrafish thymus is morphologically mature by 3 wpf. Early signs of thymic involution were observed in zebrafishaged15wpf.Danilova et al 2002, reporting that in zebrafish, the pancreas assumes the role of both the liver in fetal mice and the spleen in neonatal mice. We report here that on day 4, we detect rearrangements of genes encoding B cell receptors in DNA extracted from whole fish. Also by day 4, rag1 transcripts are seen in the pancreas, an organ not previously associated with lymphopoiesis; by day 10, Ig_ transcripts are detected here.Weinhold et al 2002 reported a method to obtain stable mutants of a gene based on knowledge of the gene sequence only. Parental fish were mutagenized with N-ethyl-N-nitrosourea;in 2679 F1 fish, the rag1 gene was analyzed for heterozygous mutations by resequencing. They found 15 mutations: 9 resulted in amino acid substitutions and 1 resulted in a premature stop codon.
GeneCloning Rag1 is contained in the BAC clone named CH211-256A21
GeneStructure This geneencodes two transcripts. (ENSDART00000073913 )consist of 3 exons and is 4318 bps in length. The protein product (ENSDARP00000068403) consists of 1,057 residues. (ENSDART00000142917)consist of 4 exons and is 4485 bps in length. The protein product (ENSDARP00000120100) consists of 1,057 residues.
Protein ENSDARP:ENSDARP00000120100; ENSDARP:ENSDARP00000068403;
ProteinDomainandFamilies InterPro:IPR001841; InterPro:IPR013083; InterPro:IPR017907; InterPro:IPR023336; InterPro:IPR024627;
Motifs Prosite:PS00518; Prosite:PS50089; Prosite:PS51487; PFAM:PF12940; UniProtKB:O13033;
Expression ArrayExpress:ENSDARG00000052122
GeneOntology GO:0006829; GO:0005515; GO:0008270; GO:0003677; GO:0004519; GO:0046872; GO:0016787; GO:0004518;
Orthologs Entrez:5896;
VariationAndRepeats RSID:rs180045571; RSID:rs41161553; RSID:rs41004426; RSID:rs40604891; RSID:rs180170752; RSID:rs41221644; RSID:rs40829111; RSID:rs40750982; RSID:rs41231298; RSID:rs40869632; RSID:rs40711696; RSID:rs40961880; RSID:rs41124199; RSID:rs40975885; RSID:rs41244112; RSID:rs41061568; RSID:rs40694483; RSID:rs41235148; RSID:rs180045553;
DisordersAndMutations ZFINID:ZDB-GENO-100528-1;ZFINID:ZDB-GENO-090610-8;ZFINID:ZDB-GENO-100426-1;ZFINID:ZDB-GENO-100426-2;ZFINID:ZDB-GENO-090925-1;ZFINID:ZDB-GENO-110111-2;The truncation mutant of rag1 was found to be homozygous viable and defective in V(D)J joining. (Erno et al. [2002])Morpholino MO1-rag1 (5' - TTCTCCATGGCGTCAGCTTATTCTC - 3') was directed against the gene rag1. Morpholino MO2-rag1 (5' - TATTATACTCACTTGAGAAGATTCA - 3') was directed against the gene rag1.Morpholino MO3-rag1 (5' - TCTTGGCAGTACCTTGCATCATTGC - 3') was directed against the gene rag1.
RelatedPubMedArticles Feng B, Bulchand S, Yaksi E, Friedrich RW, Jesuthasan S. The recombination activation gene 1 (Rag1) is expressed in a subset of zebrafish olfactory neurons but is not essential for axon targeting or amino acid detection. BMC Neurosci. 2005 Jul 15;6:46. PMID:16018818 Danilova N. Analysis of recombination signal sequences in zebrafish. Mol Immunol. ;42(10):1243-9, 2005. PMID:15829313 Lam SH, Chua HL, Gong Z, Wen Z, Lam TJ, Sin YM. Morphologic transformation of the thymus in developing zebrafish. Dev Dyn. ;225(1):87-94, 2002. PMID:12203724 Wienholds E, Schulte-Merker S, Walderich B, Plasterk RH. Target-selected inactivation of the zebrafish rag1 gene. Science. ;297(5578):99-102. 2002. PMID:12098699 Lam SH, Chua HL, Gong Z, Wen Z, Lam TJ, Sin YM. Morphologic transformation of the thymus in developing zebrafish. Dev Dyn. ;225(1):87-94.2002. PMID:12203724 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-09-01 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort