Tags:
create new tag
, view all tags

Radil

Rap GTPase interactor

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName Radil
Aliases ENSDARG:ENSDARG00000079779
Description Rap GTPase interactor
GenomicLocation chromosome 1 6566681-6586364 forward strand
ExternalIDs EMBL:EU031809; ZFIN:ZDB-GENE-071206-1; Entrez:562363; UniGene:19737
TranscriptID ENSDART:ENSDART00000110154
mRNA NCBI:NM_001102569
GeneDescription Radil gene is the novel effector of neural crest cells which give rise to various cell tissue lineages. Knockdown of radil causesmultiple defects in neural crest lineages like cartilage, pigment cells and enteric neurons in developing zebrafish embryo.
GeneFunction Smolen et al. (2007), stated radil plays a crucial role in cell adhesion and migration which points towards a mojor role of radil in Rap pathways in developmentally regulation of neural crest and broadly the role of cell adhesion in morphogenetic movements shaping the vertebrate embryo. The level of radil expression in zebrafish was regulated over the course of 7 d of development. Very low but detectable levels of radil transcript were present in one-cell embryos, suggesting the presence of maternally deposited transcripts and the levels of radil increase upon the onset of zygotic transcription (around the 1000-cell stage), eventually peaking at 72 h post-fertilization (hpf).
GeneCloning radil Contained in [BAC] DKEY-79F11
GeneStructure The gene encodes for single transcript.The transcript ENSDART00000110154 consists of 9 exons and is 1683 bps in length. The protein product (ENSDARP00000101722) consists of 560 residues.
Protein ENSDARP:ENSDARP00000101722;
ProteinDomainandFamilies has domain InterPro:IPR001478; InterPro:IPR000253; InterPro:IPR000159; InterPro:IPR002710;
Motifs has motif Prosite:PS50006; Prosite:PS50106; Prosite:PS50200; Prosite:PS51126; PFAM:PF00498; PFAM:PF00595; PFAM:PF00788; PFAM:PF01843
Expression ArrayExpress:ENSDARG00000079779
GeneOntology GO:0005515; GO:0007155; GO:0007275; GO:0001755; GO:0007165; GO:0005575
Orthologs Entrez:55698
VariationAndRepeats RSID:rs180167113; RSID:rs180048498; RSID:rs180048497; RSID:rs180048495; RSID:rs180167112
DisordersAndMutations MOs used were as follows: radil.ATG, GGCAGATGAGGAACCGTAGAACATG; radil.ATG.mm, GGCAcATcAGGAAgCGTAcAAgATG;radil.ex4d, ATTTCGGCTGA CCTGTTGGTTGTAG; radil.ex4d.mm, ATTTaGGCTcACCTcTTGa TTcTAG; radil.ex14d, CAGCACACACTCACAAGTCCATCGA; radil. ex14d.mm, CAcCAgACACTCAgAAGTCgATgGA; p53, GCGCCATT GCTTTGCAAGAATTG
RelatedPubMedArticles Gromoslaw A. Smolen, Benjamin J. Schott, Rodney A. Stewart, Sven Diederichs, Beth Muir, Heather L. Provencher, A. Thomas Look, Dennis C. Sgroi, Randall T. Peterson, and Daniel A. Haber , (2007) ; A Rap GTPase interactor, RADIL, mediates migration of neural crest precursors ; Genes Dev. ; 21(17): 21312136. PMID:17704304 . NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r5 - 2013-09-01 - SubburajK
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort