Tags:
create new tag
, view all tags

Ptc1

patched 1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName Ptc1
Aliases ENSDARG:ENSDARG00000055026; ptc-1, etID309849.2, blw, blowout,
Description patched 1
GenomicLocation chromosome 2 33685224-33711408 reverse strand
ExternalIDs Entrez:30181; ZFIN:ZDB-GENE-980526-44; UniGene:75755; EMBL:X98883;
TranscriptID ENSDART:ENSDART00000077304;
mRNA NCBI:NM_130988
GeneDescription This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently.
GeneFunction Koudijs et al. (2008) described a splice-donor mutation in Ptc1, called ptc1hu1602, which in a homozygous state resulted in a subtle eye and somite phenotype. They reported the generation and characterization of the ptc1; ptc2 double mutant assigned novel and unexpected functions to the Hh signaling pathway. They further reported that, these mutants provided a useful system to further investigate the consequences of constitutively activated Hh signaling during vertebrate development.
GeneCloning Ptc1 is contained in the BAC clone named CH211-226H23
GeneStructure The gene encodes two transcript. The first transcript ENSDART00000077304 has 22 exones and is 6344 bps long. It codes for the protien ENSDARP00000071771 which has 1442 residues. the second transcript ENSDART00000140910 has 21 exones and is 4420bps long. it codes for the protien ENSDARP00000121513 which has 1383 residues.
Protein ENSDARP00000071771
ProteinDomainandFamilies has domain InterPro:IPR000731; InterPro:IPR004766; InterPro:IPR003392;
Motifs has motif PFAM:PF02460; PRINTS:PR00702; PRINTS:PR01130; UniProt:PTC1_DANRE;
Expression ArrayExpress:ENSDARG00000055026;
GeneOntology GO:0016020; GO:0016021; GO:0043010; GO:0048635; GO:0008158; GO:0004872; GO:0010002; GO:0009954;
Orthologs Entrez:8643
VariationAndRepeats RSID:rs180045658; RSID:rs180045659; RSID:rs180045660; RSID:rs41189617; RSID:rs180045661; RSID:rs41186553; RSID:rs40758614; RSID:rs40714076; RSID:rs40925697; RSID:rs180045662; RSID:rs41054969; RSID:rs180045663; RSID:rs40943190; RSID:rs41215545; RSID:rs40741940; RSID:rs180045664; RSID:rs180045665; RSID:rs180045666; RSID:rs180045667; RSID:rs180045668
DisordersAndMutations Wenbiao et al. (2001) showed that inactivation of smoothened mutant by retroviral insertions in zebrafish resulted in defects that are characteristic of hedgehog deficiencies, including abnormalities in body size, the central nervous system, adaxial mesoderm, cartilage and pectoral fins.Morpholino MO1-ptc1 ( 5' - CATAGTCCAAACGGGAGGCAGAAGA - 3') was directed against the gene ptc1. This is a translation blocking morpholino that targets ptc1.Morpholino MO2-ptc1 (5' - CGCTGAAGAAAGTTAAAGGCAAACG - 3') was directed against the gene ptc1.This is a translation blocking morpholino that targets ptc1.
RelatedPubMedArticles Koudijs, M.J.; den, Broeder, M.J.; Groot ,E.; van, Eeden,F.J.:Genetic analysis of the two zebrafish patched homologues identifies novel roles for the hedgehog signaling pathway. BMC Dev Biol. ;8:15, 2008. PMID:18284698 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-15 - RamcharanAngom
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort