Tags:
create new tag
, view all tags

par1

paraxis

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName par1
Aliases ENSDARG:ENSDARG00000067544
Description paraxis
GenomicLocation chromosome 8 29441749-29443533 forward strand
ExternalIDs Entrez:30159; EMBL:AJ006310; UniGene:81253; ZFIN:ZDB-GENE-980605-20;
TranscriptID ENSDART:ENSDART00000097213
mRNA NCBI:NM_130972
GeneDescription

GeneFunction Shanmugalingam et al.(1998) showed that the bHLH domain of par1 shares about 95% amino acid identity to that of chick and mammalian paraxis genes. They further showed that N-terminal region of par1 shows 57% identity, and the C-terminal domain 47% identity, to equivalent regions of mouse paraxis. Shanmugalingam et al.(1998) described the expression of par1. They showed that par1 mRNA is first detected at 80% epiboly in dorsal, but not axial, mesoderm. By 100% epiboly, par1 is expressed highly in the most rostral paraxial presomitic mesoderm. At somitogenesis, par1 is expressed at presomitic mesoderm which corresponds to the next two somites. After 3-4h i.e. after the formation of each somite, par1 expression is down-regulated. By the prim5, par1 expression is observed only in small posterior ventrolateral domain of the older somites. After prim 24, par1 expression is not observed. Shanmugalingam et al.(1998) observed that spadetail (spt) mutants which failed to form somites, did not show the expression of par1 at 80% epiboly. Although, by 100% epiboly, low levels of par1 transcrips are first detected in spt- embryos.
GeneCloning Shanmugalingam et al.(1998) isolated a 120bp DNA fragment using PCR with degenerate oligonuckleotide primers. Further screening of 10-h random primed zebrafish cDNA library with this fragment led to the isolation of a positive clone that contained the full-length open reading frame for zebrafish par1.
GeneStructure par1 encodes for one transcript(ENSDART00000097213) which consists of 2 exons and transcript length of 1,041 bps. The protien product ENSDARP00000087984 has 183 residues.
Protein ENSDARP00000087984
ProteinDomainandFamilies has domain InterPro:IPR001092; InterPro:IPR011598;
Motifs has motif PFAM:PF00010; PRINTS:PR00044;
Expression ArrayExpress:ENSDARG00000067544;
GeneOntology GO:0005634; GO:0045449; GO:0030528;
Orthologs

VariationAndRepeats RSID:rs180135063: RSID:rs180135058: RSID:rs40749769
DisordersAndMutations MO1-pak2b, 5' - AATAAATGATACGTACCGACTGTTC - 3'
RelatedPubMedArticles Shanmugalingam, S.; Wilson, S.W.: Isolation, expression and regulation of zebrafish paraxis homologue. Mechanisms of Development. 78: 85-89,1998.Stickney, H.L.; Barresi, M.J.F.; Devoto, S.H.: Somite Development in Zebrafish Developmental Dynamics. 219:287-303,2000.NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-14 - RamcharanAngom
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort