Tags:
create new tag
, view all tags

musk

muscle, skeletal, receptor tyrosine kinase

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName musk
Aliases ENSDARG:ENSDARG00000000102; Unplugged; unp; fj98e12; zgc:63467; wu:fj98e12; si:dz46m7.2; si:dz57f23.3; si:busm1-57f23.3; musk
Description muscle, skeletal, receptor tyrosine kinase
GenomicLocation chromosome 10 13048113-13142776 reverse strand
ExternalIDs UniGene:152547; Entrez:334526; ZFIN:ZDB-GENE-030131-6458;
TranscriptID ENSDART:ENSDART00000064922; ENSDART:ENSDART00000000102; ENSDART:ENSDART00000038772; ENSDART:ENSDART00000148695; ENSDART:ENSDART00000111076
mRNA NCBI:NM_001004503
GeneDescription Unplugged encodes a homolog of muscle-specific kinase (MuSK) and has a role in neuromuscular synaptogenesis and axonal guidance pathway.
GeneFunction Lefebvre et al., 2007 showed that one of three transcripts generated by the zebrafish unplugged locus, unplugged FL, encodes the zebrafish MuSK ortholog. They also demonstrate that UnpFL/MuSK is critical for the assembly of focal synapses in zebrafish and that it cooperates with dystroglycan in the formation of nonfocal myoseptal and distributed synapses. It is evident from their results that the combinatorial function of UnpFL/MuSK and dystroglycan generates diverse patterns of vertebrate neuromuscular innervations.Schweitzer J et al., 2005 showed that unplugged is involved in the regulation pathway of the tenascin-C protein which is a component of the extracellular matrix of the region of the horizontal myoseptum that influences the growth of motor axons of zebrafish.Zhang J et al.,2004 showed that unplugged encodes a homolog of muscle-specific kinase (MuSK) and has only a limited role in neuromuscular synaptogenesis. They demonstrated that unplugged is transiently expressed in cells adjacent to the somitic choice point of motor axons helping to correct decisions at the choice point . They further stated that unplugged signaling before the arrival of growth cones induces changes in the extracellular environment. The unplugged locus generates three different transcripts out of which one splice variant isoform lacks the extracellular modules essential for agrin responsiveness, and signaling through this isoform mediates axonal pathfinding, independent of the MuSK downstream component rapsyn.Granato M et al., 1996 stated that unplugged gene, regulating axonal guidance of motor neurons are involved in the control and mediation of locomotion behavior of the zebrafish embryo and larva.
GeneCloning The gene is contained in BAc clone DKEYP-84G6 (Vector: pIndigoBAC-536).
GeneStructure The gene encodes 4 transcripts all of which are known protein coding. The first transcript (ENSDART00000000102) has 7 exons and is 1,662 bps in length. The protein product (ENSDARP00000000102) is of 553 residues. The second transcript (ENSDART00000038772) has 16 Exons and is 3,462 bps in length. The protein product (ENSDARP00000028386) is of 941 residues. The third transcript (ENSDART00000064922) has 17 Exons and is 3,395 bps in length. The protein product (ENSDARP00000064921) is of 941 residues. The fourth transcript (ENSDART00000001253) has 5 Exons and is 935 bps in length . The protein product (ENSDARP00000001953) is 144 residues.
Protein ENSDARP00000064921 ENSDARP00000000102 ENSDARP00000028386 ENSDARP00000124735 ENSDARP00000099310
ProteinDomainandFamilies has domain InterPro:IPR000001; InterPro:IPR001245; InterPro:IPR017441; InterPro:IPR008266; InterPro:IPR000719; InterPro:IPR013783; InterPro:IPR007110; InterPro:IPR000024; InterPro:IPR013098; InterPro:IPR003598;
Motifs has motif Prosite:PS00021; Prosite:PS00107; Prosite:PS00109; PFAM:PF00031; PFAM:PF00047; PFAM:PF00051; PFAM:PF00069; PFAM:PF01392; PFAM:PF07679; PFAM:PF07714; PRINTS:PR00018; PRINTS:PR00109; PRINTS:PR01505; PRINTS:PR01536;
Expression ArrayExpress:ENSDARG00000000102;
GeneOntology GO:0042802; GO:0005524; GO:0016301; GO:0000166; GO:0004672; GO:0004713; GO:0016740; GO:0016772; GO:0005515; GO:0016310; GO:0006468; GO:0008045; GO:0030517; GO:0043113; GO:0071340; GO:0051124; GO:0016021; GO:0045211
Orthologs

VariationAndRepeats RSID:rs180130274; RSID:rs180130275; RSID:rs40915270; RSID:rs41034990; RSID:rs40731279; RSID:rs180130276; RSID:rs180130277; RSID:rs180130278; RSID:rs41149111; RSID:rs41198620; RSID:rs41218644; RSID:rs180130279; RSID:rs180130280; RSID:rs180130281; RSID:rs180130282; RSID:rs40747561; RSID:rs40926814; RSID:rs40923967; RSID:rs40807937; RSID:rs180129684; RSID:rs40695012; RSID:rs41216256; RSID:rs40751253; RSID:rs40911313; RSID:rs180130322; RSID:rs180130321; RSID:rs40853813; RSID:rs180130320; RSID:rs179615193; RSID:rs180130319; RSID:rs180130318; RSID:rs40670359; RSID:rs179615202; RSID:rs41229977; RSID:rs40750597; RSID:rs40672340; RSID:rs40981846; RSID:rs40990414; RSID:rs40794851; RSID:rs40719842; RSID:rs179615203; RSID:rs40670356; RSID:rs40670355; RSID:rs179615198; RSID:rs40670354; RSID:rs40648177; RSID:rs180130317; RSID:rs179615192; RSID:rs180130316
DisordersAndMutations Zebrafish unplugged mutants have been characteried to display pathfinding defects in the region of the horizontal myoseptum, also show abnormal extracelllar matrix. It has been shown that in the zebrafish mutant unplugged, two of the three segmental motor axons make incorrect decisions at a somitic choice point.The morpholino oligonucleotide designed to knockdown the unplugged/musk gene has been targeted against the splice donor site of musk splice variant (SV1) exon 2. The sequence of the oligonucleotide is as follows- 5' - TATTGTCTTACCTCCATTCTACGGG - 3' (Granato M et al. 1996). The ENU induced homozygous mutant alleles p31cd, tbb72, tbo81, tbr160, tb307, te314b have been isolated and possess point mutation in the musk gene.
RelatedPubMedArticles Granato, M; van Eeden, FJ; Schach, U; Trowe, T; Brand, M; Furutani-Seiki, M; Haffter, P; Hammerschmidt, M; Heisenberg, CP; Jiang, YJ; Kane, DA; Kelsh, RN; Mullins, MC; Odenthal, J; Nüsslein-Volhard, C. (1996). Genes controlling and mediating locomotion behavior of the zebrafish embryo and larva. Development. 123:399-413, PMID:9007258 .Zhang, J; Lefebvre, JL; Zhao, S; Granato, M. (2004). Zebrafish unplugged reveals a role for muscle-specific kinase homologs in axonal pathway choice. Nat Neurosci. 7(12):1303-9. PMID:15543140 .Schweitzer, J; Becker, T; Lefebvre, J; Granato, M; Schachner, M; Becker, CG. (2005). Tenascin-C is involved in motor axon outgrowth in the trunk of developing zebrafish. Dev Dyn. 234(3):550-66, PMID:16110513 .Lefebvre, JL; Jing, L; Becaficco, S; Franzini-Armstrong, C; Granato, M. (2007). Differential requirement for MuSK and dystroglycan in generating patterns of neuromuscular innervation. Proc Natl Acad Sci U S A. 104(7):2483-8. PMID:17284594 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-07-31 - SrishtiNanda
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort