Tags:
create new tag
, view all tags

mib

mind bomb

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName mib
Aliases ENSDARG:ENSDARG00000008424; fe47f05; white tail; wit; cg5841; KIAA1323; chunp6889; im:7148100; wu:fe47f05; mib
Description mind bomb
GenomicLocation Scaffold Zv7_NA998: 169,705-196,449 forward strand.
ExternalIDs Entrez:352910; EMBL:AF537301; UniGene:124112; ZFIN:ZDB-GENE-030404-2;
TranscriptID ENSDART:ENSDART00000128234
mRNA NCBI:NM_173286
GeneDescription Mind bomb (mib) encodes RING E3 ubiquitin ligases that promote Delta ubiquitylation and endocytosis during Notch activation.
GeneFunction Bingham S et al. (2003) characterized in detail the hindbrain phenotype of mib mutants. They showed that mib regulates the differentiation of neuroepithelial cells into neurons and the mib mediated Notch signaling preserves a population of non-neuronal cells that are essential for maintaining patterning mechanisms in the developing neural tube.Chandrasekharappa et al. (2003) revealed that mib is a gene in the Notch pathway that encodes a RING ubiquitin ligase. Mib interacts with the intracellular domain of Delta to promote its ubiquitylation and internalization. They also showed that mib function is essential in the signaling cell for efficient activation of Notch in neighboring cells.Chen w et al. (2004) showed that the three functionally distinct modules of Mind bomb- the N-terminal half, the ankyrin repeats and the ring fingers , required for delta signalling, work cooperatively to regulate Notch signaling by associating with, ubiquitinating, and internalizing Delta.Zhang C et al. (2007) analysed mutant alleles of the mind bomb gene and showed that mib along with mib2 colocalized in transfected cells and function redundantly in regulating Notch signaling in embryos. They also showed that the gene is negatively regulated by notch signalling in a Su(H)-dependent manner, forming a negative feedback loop in modulating Notch activation.Zhang C et al. (2007) demonstrated that mib have a C-terminal-most RING finger-dependent E3 ubiquitin ligase activity and functions in notch signalling along wih mib2 by using DeltaC as a common substrate. Mib and Mib2 form homo or hetero-oligomers and ubiquitylate themselves and each other. They also showed that Mib and Mib2 facilitate DeltaC internalization, but only Mib facilitates that of DeltaD.
GeneCloning It is contained in [BAC] DKEY-2P18 and [FOSMID] CH1073-221A23
GeneStructure The gene encodes for a single transcript (ENSDART00000015609) having 11 exons and is 2,435 bps in length. The protein product (ENSDARP00000002442) consists of 559 residues.
Protein ENSDARP00000109025
ProteinDomainandFamilies has domain InterPro:IPR000433; InterPro:IPR010606; InterPro:IPR001841; InterPro:IPR013083; InterPro:IPR002110;
Motifs has motif Prosite:PS01357; PFAM:PF00023; PFAM:PF00569; PFAM:PF06701; PRINTS:PR01415; UniProt:MIB1_DANRE;
Expression ArrayExpress:ENSDARG00000008424
GeneOntology GO:0016020; GO:0005579; GO:0005737; GO:0000151; GO:0030139; GO:0048471; GO:0045664; GO:0045685; GO:0007219; GO:0031076; GO:0048547; GO:0008284; GO:0048793; GO:0001756; GO:0006829; GO:0030097; GO:0021986; GO:0007368; GO:0048699; GO:0010001; GO:0045747; GO:0016567; GO:0030182; GO:0009880; GO:0021521; GO:0021508; GO:0002090; GO:0051865; GO:0008270; GO:0005515; GO:0046872; GO:0016874; GO:0004842; GO:0042803;
Orthologs

VariationAndRepeats

DisordersAndMutations The mind bomb mutants have been characterized to show reduced number of hindbrain branchiomotor neurons (BMNs ) (Bingham S et al. (2003)).Certain other mutant alleles such as Mib(ta52b) with a missense mutation in the C-terminal-most RING finger (M1013R) and Mib(m132) possess a premature stop codon that leads to a deletion of three RING fingers (C785stop), an important module of mind bomb gene function (Zhang C et al. (2007)).Zebrafish mib mutant embryos also show reduced lateral inhibition that permits too many neural progenitors to differentiate as neurons (Chandrasekharappa et al. (2003)) .Th following morpholino oligonucleotides have been directed against the mind bomb gene mib MO 5' - TAACTCGAGCACCCACTCCTTCCAT - 3'.The following mutant alleles of the mib gene have been characterized.zebrafish mib(ta52b) allele having a missense mutation in the C-terminal RING Finger (RF). Mib(m132) allele showing nonsense mutation resulting in a truncated protein that loses all three RFs. The null allele, mib(tfi91) shows a nonsense mutation resulting in a truncated protein of only 60 amino acids.
RelatedPubMedArticles Itoh, M; Kim, CH; Palardy, G; Oda, T; Jiang, YJ; Maust, D; Yeo, SY; Lorick, K; Wright, GJ; Ariza-McNaughton, L; Weissman, AM; Lewis, J; Chandrasekharappa, SC and Chitnis, AB. (2003). Mind Bomb is a ubiquitin ligase that is essential for efficient activation of notch signaling by Delta. Dev. Cell 4(1): 67-82. PMID:12530964 .Chen, W; Casey, Corliss, D. (2004). Three modules of zebrafish Mind bomb work cooperatively to promote Delta ubiquitination and endocytosis. Dev Biol. 15;267(2):361-73. PMID:15013799 .Zhang, C; Li, Q; Lim, CH; Qiu, X; Jiang, YJ. (2007).The characterization of zebrafish antimorphic mib alleles reveals that Mib and Mind bomb-2 (Mib2) function redundantly. Dev Biol. 305(1):14-27. PMID:17331493 .Zhang, C; Li, Q; Jiang, YJ. (2006). Zebrafish Mib and Mib2 are mutual E3 ubiquitin ligases with common and specific delta substrates. J Mol Biol. 2;366(4):1115-28. PMID:17196985 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-30 - SrishtiNanda
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort