Tags:
create new tag
, view all tags

med12

mediator of RNA polymerase II transcription, subunit 12 homolog

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName med12
Aliases ENSDARG:ENSDARG00000056800; med12
Description mediator of RNA polymerase II transcription, subunit 12 homolog
GenomicLocation chromosome 14 24569066-24583627 forward strand
ExternalIDs Entrez:566632; UniGene:79193; ZFIN:ZDB-GENE-060125-1;
TranscriptID ENSDART:ENSDART00000149279; ENSDART:ENSDART00000148750; ENSDART:ENSDART00000079327
mRNA NCBI:NM_001039461
GeneDescription Med12 is a regulatory subunit of the transcriptional Mediator complex. The gene modulates the ability of Casanova/Sox32 to induce sox17 expression.
GeneFunction Hong SK et al. (2005) showed that critical targets of TRAP230 function also known as MED12 may include proteins important for cell mobility, cell sorting, and tissue assembly. They studied the kohtalo mutant zebrafish embryos and stated that the gene plays an important role in brain morphogenesis, neural crest, and kidney development.Wang X et al. (2006) revealed that mot encodes Med12, a component of the evolutionarily conserved Mediator complex. They further investigated the regulatory role of Mot/Med12 in vertebrate neuronal development and found out that mot/med12 is necessary to regulate, and when overexpressed is capable of increasing, the expression of distinct neuronal determination genes, including zash1a and lim1, and serves as an in vivo cofactor for Sox9 in this process. Rau MJ et al. (2006) established the critical function of the Trap230 subunit as a coactivator for Sox9. They showed by means of mutation studies that the Mediator is a coactivator complex transducing the interaction of DNA-binding transcription factors with RNA polymerase II. Shin CH et al. (2008) showed that Med12 interacts with various transcriptional factors at distinct steps of endoderm development to regulate cell differentiation. Gain-of-function experiments with Cas/Sox32 revealed that Med12 modulates the activity of this key regulator of endoderm formation, while loss-of-function experiments reveal genetic interactions between Med12 and Foxa2. They also showed that med12 mutants exhibit multiple endodermal defects including delayed differentiation of specific cell types in the liver and pancreas
GeneCloning It is contained in [BAC] CH211-66G21, CH211-119P14
GeneStructure This gene codes for three transcripts. ENSDART00000149279 consists of 10 exons, 2006 bps and codes for a 560 residue long product ENSDARP00000124576. ENSDART00000148750 consists of 7 exons, 822 bps and codes for a 266 residue long protein ENSDARP00000124064. ENSDART00000079327 consists of 5 exons, 909 bps and codes for a 302 amino acid residue long product ENSDARP00000073783.
Protein ENSDARP00000124576 ENSDARP00000124064 ENSDARP00000073783
ProteinDomainandFamilies has domains Pfam:PF12145
Motifs has motifs PFAM:PF09497; PFAM:PF12144; PFAM:PF12145
Expression ArrayExpress:ENSDARG00000056800
GeneOntology has domains GO:0001104; GO:0008013; GO:0003700; GO:0007275; GO:0006357; GO:0006355; GO:0006351; GO:0007492; GO:0045893; GO:0048702; GO:0035118; GO:0048703 GO:0030900; GO:0050935; GO:0001822; GO:0030901; GO:0014032; GO:0030182; GO:0002761; GO:0021654; GO:0016592; GO:0005634
Orthologs

VariationAndRepeats RSID:rs40881283; RSID:rs40881283; RSID:rs40881283; RSID:rs40853005; RSID:rs40853005; RSID:rs40853005; RSID:rs40859349; RSID:rs40859349; RSID:rs40859349; RSID:rs40721051; RSID:rs40721051; RSID:rs40721051; RSID:rs40753840; RSID:rs40753840; RSID:rs40753840; RSID:rs41236203; RSID:rs41236203; RSID:rs41236203; RSID:rs41147754; RSID:rs41147754; RSID:rs41147754; RSID:rs41237541; RSID:rs41237541; RSID:rs41237541; RSID:rs40905118; RSID:rs40905118; RSID:rs40905118; RSID:rs41097145; RSID:rs41097145; RSID:rs41097145; RSID:rs41203598; RSID:rs41203598; RSID:rs41203598; RSID:rs41174710; RSID:rs41174710; RSID:rs41174710; RSID:rs41009898; RSID:rs41009898; RSID:rs41009898; RSID:rs41020290; RSID:rs41020290; RSID:rs41020290; RSID:rs41193591; RSID:rs41193591; RSID:rs41193591; RSID:rs41191651; RSID:rs41191651; RSID:rs41191651; RSID:rs40815665; RSID:rs40815665; RSID:rs40815665; RSID:rs41208551; RSID:rs41208551; RSID:rs41208551; RSID:rs40763627; RSID:rs40763627; RSID:rs40763627; RSID:rs41068403; RSID:rs41068403; RSID:rs41068403; RSID:rs40989179; RSID:rs40989179; RSID:rs40989179; RSID:rs41037871; RSID:rs41037871; RSID:rs41037871; RSID:rs41093232; RSID:rs41093232; RSID:rs41093232; RSID:rs40914323; RSID:rs40914323; RSID:rs40914323; RSID:rs40913158; RSID:rs40913158; RSID:rs40913158; RSID:rs40710372; RSID:rs40710372; RSID:rs40710372; RSID:rs40685409; RSID:rs40685409; RSID:rs40685409; RSID:rs41154243; RSID:rs41154243; RSID:rs41154243; RSID:rs40792080; RSID:rs40792080; RSID:rs40792080; RSID:rs41188741; RSID:rs41188741; RSID:rs41188741; RSID:rs41037086; RSID:rs41037086; RSID:rs41037086; RSID:rs40839056; RSID:rs40839056; RSID:rs40839056; RSID:rs41072836; RSID:rs41072836; RSID:rs41072836; RSID:rs40898616; RSID:rs40898616; RSID:rs40898616; RSID:rs40995812; RSID:rs40995812; RSID:rs40995812; RSID:rs40693260; RSID:rs40693260; RSID:rs40693260; RSID:rs41218048; RSID:rs41218048; RSID:rs41218048; RSID:rs40913141; RSID:rs40913141; RSID:rs40913141; RSID:rs41090728; RSID:rs41090728; RSID:rs41090728; RSID:rs41198133; RSID:rs41198133; RSID:rs41198133; RSID:rs40866588; RSID:rs40866588; RSID:rs40866588; RSID:rs40750997; RSID:rs40750997; RSID:rs40750997; RSID:rs41021160; RSID:rs41021160; RSID:rs41021160; RSID:rs41202157; RSID:rs41202157; RSID:rs41202157; RSID:rs41005708; RSID:rs41005708; RSID:rs41005708; RSID:rs41227028; RSID:rs41227028; RSID:rs41227028; RSID:rs40620119; RSID:rs40620119; RSID:rs40620119; RSID:rs41200860; RSID:rs41200860; RSID:rs41200860; RSID:rs40804870; RSID:rs40804870; RSID:rs40804870; RSID:rs41188271; RSID:rs41188271; RSID:rs41188271; RSID:rs40870699; RSID:rs40870699; RSID:rs40870699; RSID:rs41239911; RSID:rs41239911; RSID:rs41239911; RSID:rs40845946; RSID:rs40845946; RSID:rs40845946; RSID:rs41143178; RSID:rs41143178; RSID:rs40797071; RSID:rs40797071; RSID:rs41115018; RSID:rs41115018; RSID:rs41246613; RSID:rs41246613; RSID:rs40780674; RSID:rs40780674; RSID:rs40953129; RSID:rs40953129; RSID:rs41055037; RSID:rs41055037; RSID:rs41198511; RSID:rs41198511; RSID:rs41158177; RSID:rs41158177; RSID:rs41049203; RSID:rs41049203; RSID:rs41093918; RSID:rs41093918; RSID:rs40993217; RSID:rs40993217; RSID:rs40842636; RSID:rs40842636; RSID:rs41161412; RSID:rs41161412; RSID:rs41166515; RSID:rs41166515; RSID:rs41156700; RSID:rs41156700; RSID:rs41161984; RSID:rs41161984; RSID:rs41208262; RSID:rs41208262; RSID:rs40743218; RSID:rs40743218; RSID:rs41096273; RSID:rs41096273; RSID:rs40775536; RSID:rs40775536; RSID:rs41103885; RSID:rs41103885; RSID:rs41081572; RSID:rs41081572; RSID:rs40847064; RSID:rs40847064; RSID:rs41226252; RSID:rs41226252; RSID:rs40972989; RSID:rs40972989; RSID:rs40804317; RSID:rs40804317; RSID:rs40779971; RSID:rs40779971; RSID:rs40972464; RSID:rs40972464; RSID:rs41038257; RSID:rs41038257; RSID:rs41237944; RSID:rs41237944; RSID:rs40943941; RSID:rs40943941; RSID:rs40776535; RSID:rs40776535; RSID:rs40976800; RSID:rs40976800; RSID:rs40765923; RSID:rs40765923; RSID:rs41016664; RSID:rs41016664; RSID:rs41236905; RSID:rs41236905; RSID:rs40691505; RSID:rs40691505; RSID:rs40695620; RSID:rs40695620; RSID:rs40816589; RSID:rs40816589; RSID:rs40846337; RSID:rs40846337; RSID:rs40912758; RSID:rs40912758; RSID:rs40708166; RSID:rs40708166; RSID:rs40928966; RSID:rs40928966; RSID:rs40726714; RSID:rs40726714; RSID:rs41162538; RSID:rs41162538; RSID:rs41208094; RSID:rs41208094; RSID:rs41083121; RSID:rs41083121; RSID:rs40654091; RSID:rs40654091; RSID:rs40678990; RSID:rs40678990; RSID:rs40651151; RSID:rs40651151; RSID:rs40652597; RSID:rs40652597; RSID:rs40664299; RSID:rs40664299; RSID:rs40631072; RSID:rs40631072; RSID:rs40632025; RSID:rs40632025; RSID:rs40630568; RSID:rs40630568; RSID:rs40678991; RSID:rs40678991; RSID:rs41059329; RSID:rs41059329; RSID:rs40695178; RSID:rs40695178; RSID:rs40737728; RSID:rs40737728; RSID:rs40650618; RSID:rs40650618; RSID:rs40652101; RSID:rs40652101; RSID:rs41116095; RSID:rs41116095; RSID:rs41096387; RSID:rs41096387; RSID:rs40727398; RSID:rs40727398; RSID:rs40758462; RSID:rs40758462; RSID:rs40708473; RSID:rs40708473; RSID:rs41027038; RSID:rs41027038; RSID:rs41009741; RSID:rs41009741; RSID:rs40947854; RSID:rs40947854; RSID:rs41242056; RSID:rs41242056; RSID:rs41225066; RSID:rs41225066; RSID:rs41189087; RSID:rs41189087; RSID:rs40679993; RSID:rs40679993
DisordersAndMutations The Motionless (mot) mutants show disrupted Med12 function in zebrafish. The mutation affects neuronal development in zebrafish, displays deficits of monoaminergic neurons and cranial sensory ganglia (Wang X et al. (2006)). The kohtalo (kto) mutation is an ENU-induced allele of the Mediator component thyroid hormone receptor-associated protein (TRAP)230/MED12. Homozygous kto mutant zebrafish embryos show defects in brain, neural crest, and kidney development (Hong SK et al. (2005)).A morpholino (MO) antisense knockdown oligonucleotide for trap230/MED 12 has been previously. The sequence of the antisense morpholino ologonucleotide is as follows 5′-CAGAACGCCGAAGGCAGCCATCAT-3’ where the CAT sequence corresponds to the start codon .Trap230 splice morpholino oligonucleotide (MO) has the sequence CAGATCCTCTAAAAATCATCACCTG designed to target the exon 26–intron 26 splice junction.A MO targeted to the fourth intro/exon boundary of the med12 gene has been constructed , the sequence of which is - 5’ acacactgacctatacaggggtcga 3’.
RelatedPubMedArticles Hong, S.K.; Haldin, C.E.; Lawson, N.D.; Weinstein, B.M.; Dawid, I.B.; Hukriede, N.A.: The zebrafish kohtalo/trap230 gene is required for the development of the brain, neural crest, and pronephric kidney. Proc Natl Acad Sci U S A.102(51):18473-8,2005. PMID:16344459 .Rau, M.J.; Fischer, S.; Neumann, C.J.: Zebrafish Trap230/Med12 is required as a coactivator for Sox9-dependent neural crest, cartilage and ear development. Dev Biol. 296(1):83-93, 2006. PMID:16712834 .Wang, X.; Yang,N.; Uno, E.; Roeder, R.G.; Guo, S: A subunit of the mediator complex regulates vertebrate neuronal development. Proc Natl Acad Sci U S A.103(46):17284-9, 2006. PMID:17088561 . Shin, C.H.; Chung, W.S.; Hong, S.K.; Ober, E.A.; Verkade, H.; Field, H.A.; Huisken, J.; Stainier, D.Y.: Multiple roles for Med12 in vertebrate endoderm development. Dev Biol.317(2):467-79,2008. PMID:18394596 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-07-30 - SrishtiNanda
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort