Tags:
create new tag
, view all tags

lama5

laminin, alpha 5

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName lama5
Aliases ENSDARG:ENSDARG00000058543; cb402; sb:cb402; im:7138247; wu:fb81a10; lama5
Description laminin, alpha 5
GenomicLocation chromosome 23 9674223-9875589 reverse strand
ExternalIDs Entrez:321243; EMBL:BC090434; UniGene:12091; ZFIN:ZDB-GENE-030131-9823;
TranscriptID ENSDART:ENSDART00000045126
mRNA NCBI:NM_001039171
GeneDescription Laminins are a family of glycoproteins and are among the first extracellular matrix proteins required for normal development. Through polymerisation, laminins form a sheet-like matrix that is a major component of basement membranes. Laminins are obligate heterotrimeric protein complexes consisting of a, h and g chains, of which there are multiple forms.
GeneFunction Webb et al. (2007) reported non-sense mutation in zebrafish lama5 gene that truncates laminin α5 before the C-terminal laminin LG domains, thereby preventing laminin α5 from interacting with its cell surface receptors. In lama5 mutant, pectoral fins fail to make transition from an apical epidermal ridge to an apical fold. They proposed the role of laminin α5 in organizing the distal cells of the fin fold and pectoral fins in order to promote the morphogenesis of the epidermis.
GeneCloning The gene is contained in three BAC clones CH73-78G5 (Vector: pTARBAC2) , DKEY-14P11 (Vector: pIndigoBAC-536) and DKEY-204F1 (Vector: pIndigoBAC-536).
GeneStructure Lama5 encodes 1 transcript. ENSDART00000045126 consists of 80 exons and 11,542 bps. The protein product ENSDARP00000045125 consists of 3,664 residues.
Protein ENSDARP00000045125
ProteinDomainandFamilies has domain InterPro:IPR018031; InterPro:IPR002049; InterPro:IPR008985; InterPro:IPR000034; InterPro:IPR010307; InterPro:IPR013320; InterPro:IPR001791; InterPro:IPR009254; InterPro:IPR013032; InterPro:IPR008211; InterPro:IPR000742; InterPro:IPR012680;
Motifs has motif Prosite:PS51117, Prosite:PS51115; Prosite:PS50027; Prosite:PS50025; Prosite:PS50026; Prosite:PS00022; Prosite:PS00652; Prosite:PS01186; Prosite:PS01248; PFAM:PF00052; PFAM:PF00053; PFAM:PF00054; PFAM:PF00055; PFAM:PF02210; PFAM:PF06008; PFAM:PF06009; PRINTS:PR00011;
Expression ArrayExpress:ENSDARG00000058543
GeneOntology GO:0005102, GO:0007155, GO:0030155, GO:0030334, GO:0045995, GO:0016337, GO:0033333, GO:0033334, GO:0035141, GO:0035138, GO:0008104, GO:0005604, GO:0005606
Orthologs Entrez:3911;
VariationAndRepeats RSID:rs41220175; RSID:rs180064741; RSID:rs40848333; RSID:rs41108585; RSID:rs40885440; RSID:rs41095097; RSID:rs40781505; RSID:rs41222219; RSID:rs41137811; RSID:rs41066101; RSID:rs40876426; RSID:rs40886295; RSID:rs40847079; RSID:rs41109617; RSID:rs40755907; RSID:rs40697880; RSID:rs40856238; RSID:rs41049732; RSID:rs40747579; RSID:rs41181682; RSID:rs40934618; RSID:rs41080871; RSID:rs40977931; RSID:rs41134674; RSID:rs40932138; RSID:rs40836257; RSID:rs41156060; RSID:rs40612339; RSID:rs40895292; RSID:rs40934190; RSID:rs41091273; RSID:rs40958482; RSID:rs40851039; RSID:rs40979218; RSID:rs41131172; RSID:rs40839211; RSID:rs40718421; RSID:rs40842243; RSID:rs41192502; RSID:rs180064743; RSID:rs179597083; RSID:rs179596697; RSID:rs179597171; RSID:rs40740085; RSID:rs179597268; RSID:rs179596865; RSID:rs40857757; RSID:rs179596830; RSID:rs179597124; RSID:rs179597162; RSID:rs179596772; RSID:rs179596795; RSID:rs179596924; RSID:rs179597336; RSID:rs179597069; RSID:rs179597195; RSID:rs179596961; RSID:rs179596805; RSID:rs179597111; RSID:rs179596740; RSID:rs179597507; RSID:rs179597410; RSID:rs179596781; RSID:rs179597372; RSID:rs179597254; RSID:rs179596992; RSID:rs40757670; RSID:rs41093021; RSID:rs40986442; RSID:rs41174573; RSID:rs41049743; RSID:rs41161848; RSID:rs41017354; RSID:rs41126140; RSID:rs41116173; RSID:rs41048323; RSID:rs41231235; RSID:rs41114855; RSID:rs40668316; RSID:rs40728619; RSID:rs41200504; RSID:rs40728171; RSID:rs40867578; RSID:rs40785823; RSID:rs40866346; RSID:rs41126866; RSID:rs41089268; RSID:rs40719997; RSID:rs41200920; RSID:rs40903380; RSID:rs41049627; RSID:rs41184812; RSID:rs179597337; RSID:rs179597449; RSID:rs179596871; RSID:rs179597464; RSID:rs179596957; RSID:rs179597211; RSID:rs179596700; RSID:rs179597123; RSID:rs180064746; RSID:rs41004133; RSID:rs41067298; RSID:rs40687312; RSID:rs41116030; RSID:rs40930580; RSID:rs41031125; RSID:rs40918890; RSID:rs40938530; RSID:rs41040281; RSID:rs40893703; RSID:rs179597074; RSID:rs179597452; RSID:rs179596886; RSID:rs179597266; RSID:rs41117357; RSID:rs179597176; RSID:rs179596841; RSID:rs179597491; RSID:rs179597163; RSID:rs179596763; RSID:rs40929314; RSID:rs180064747; RSID:rs40924459; RSID:rs180064748; RSID:rs180064749; RSID:rs180064750; RSID:rs179916189; RSID:rs41101987; RSID:rs180064751; RSID:rs180064752; RSID:rs180064753; RSID:rs180064754; RSID:rs180064755; RSID:rs180064756; RSID:rs180064757; RSID:rs180064758; RSID:rs180064759; RSID:rs180064760; RSID:rs179916190; RSID:rs180064761; RSID:rs180064762; RSID:rs180064763; RSID:rs180064764; RSID:rs180064765; RSID:rs180064766; RSID:rs180064767; RSID:rs180064768; RSID:rs180064769; RSID:rs180064770; RSID:rs180064771; RSID:rs180064772; RSID:rs180064773; RSID:rs180064774; RSID:rs180064775; RSID:rs180064776; RSID:rs180064777; RSID:rs179579219; RSID:rs180064778; RSID:rs180064779; RSID:rs180064780; RSID:rs180064781; RSID:rs180064783; RSID:rs180064784; RSID:rs180064785; RSID:rs180064786; RSID:rs180064787; RSID:rs180064788; RSID:rs180064789
DisordersAndMutations ZFINID:ZDB-GENO-090605-75;ZFINID:ZDB-GENO-080109-2;ZFINID:ZDB-GENO-980202-664;ZFINID:ZDB-GENO-100528-9;ZFINID:ZDB-GENO-980202-900;ZFINID:ZDB-GENO-111010-29;ZFINID:ZDB-GENO-980202-1253;ZFINID:ZDB-GENO-111010-30;ZFINID:ZDB-GENO-980202-1255;ZFINID:ZDB-GENO-980202-1254;Pollard et al. (2006) identified cDNA sequences for lama2, lama4 and lama5 and disrupted the expression of each genes alone or in mutant embryos also lacking laminin a1. For low dose Morpholino injected lama5 MO: CTCGTCCTGATGGTCCCCTCGCCAT they observed the normal morphological appearance of notochord that indicates the formation of the peri-notochordal basement membrane, through polymerization of laminin that serves not only as an essential mechanical structure but also mediate a differentiation signal.
RelatedPubMedArticles Pollard, S. M.; Parsons, M. J.; Kamei, M.; Kettleborough, R. N.; Thomas, K. A.; Pham, V. N.; Bae, M. K.; Scott, A.; Weinstein, B. M.; Stemple, D. L.: Essential and overlapping roles for laminin alpha chains in notochord and blood vessel formation. Dev Biol. 2006 Jan 1;289(1):64-76. PMID:16321372 Webb, A. E.; Sanderford, J.; Frank, D.; Talbot, W. S.; Driever, W.; Kimelman, D.: Laminin alpha5 is essential for the formation of the zebrafish fins. Dev Biol. 2007 Nov 15;311(2):369-82. Epub 2007 Aug 28. PMID:17919534 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-26 - Kriti66Kaushik87
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort