Tags:
create new tag
, view all tags

isl1

islet1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName isl1
Aliases ENSDARG:ENSDARG00000004023; Isl-1; islet-1
Description islet1
GenomicLocation chromosome 5 42353743-42359175 reverse strand
ExternalIDs Entrez:30147; ZFIN:ZDB-GENE-980526-112;
TranscriptID ENSDART:ENSDART00000010896
mRNA NCBI:NM_130962
GeneDescription Islet-1 (Isl1) is a member of the Isl1 family of LIM-homeodomain transcription factors (LIM-HD) that is expressed in a defined subset of motor and sensory neurons during vertebrate embryogenesis.
GeneFunction Uemura et al., 2005 in an effort to identify how specific expression of isl1 is regulated identified two enhancer elements CREST1 and CREST2 downstream of the isl1 locus.Hutchinson SA et al.,2006 showed that Islet1 is required for formation of zebrafish primary motoneurons. They also provided evidence that Islet2 can substitute for Islet1 during primary motoneuron formation. They found out that primary motoneuron subtypes are likely to be specified by factors that act in parallel to or upstream of islet1 and islet2 and not by differences in these two proteins.Hutchinson SA et al.,2007 used individually identified zebrafish primary motoneurons to describe a novel role for Nkx6 and Islet1 proteins in the specification of vertebrate motoneuron subtypes. They provided evidences suggesting that Islet1 acts downstream of Nkx6. They postulated that by maintainence of the islet1 expression by Nkx6 proteins is required both to promote the MiP subtype and to suppress interneuron development.
GeneCloning The gene is contained in BAC clone CH211-219F7 (Vector: pTARBAC2.1).
GeneStructure The gene encodes a single transcript:(ENSDARG00000004023) which consists of 6 exons and is 2,285 bps in length. The protein product (ENSDARP00000012903) consists of 349 residues.
Protein ENSDARP00000012903
ProteinDomainandFamilies has domain InterPro:IPR001781; InterPro:IPR001356; InterPro:IPR012287;
Motifs has motif Prosite:PS00027; Prosite:PS00478; PFAM:PF00046; PFAM:PF00412; PRINTS:PR00031;
Expression ArrayExpress:ENSDARG00000004023;
GeneOntology GO:0005634; GO:0045449; GO:0006355; GO:0048665; GO:0006829; GO:0003700; GO:0008270; GO:0003677; GO:0043565; GO:0046872;
Orthologs Entrez:3670;
VariationAndRepeats RSID:rs40606040; RSID:rs40605305; RSID:rs40617923; RSID:rs40625863; RSID:rs40597078; RSID:rs40610591; RSID:rs40614988; RSID:rs40619522; RSID:rs40622319; RSID:rs40602171; RSID:rs40611187 ss252392187; RSID:rs40850903; RSID:rs41163333; RSID:rs40611648; RSID:rs40624646; RSID:rs41035876 "
DisordersAndMutations ZFINID:ZDB-GENO-110207-17;ZFINID:ZDB-GENO-091008-1;ZFINID:ZDB-GENO-110823-7;ZFINID:ZDB-GENO-090527-7;ZFINID:ZDB-GENO-080814-4;ZFINID:ZDB-GENO-090528-4;targets the translation start codon and 22 upstream nucleotides 5' - CATGTCAAGAAAGTAAGGCGGTGTT - 3'islet1 translation blocking MO beginning at position 25 in the 5'UTR (5'-CCCATGTCAAGAAAGTAAGGCGGTG-3').
RelatedPubMedArticles Hutchinson, S.A.; Cheesman, S.E.; Hale, L.A.; Boone, J.Q.; Eisen, J.S.: Nkx6 proteins specify one zebrafish primary motoneuron subtype by regulating late islet1 expression. Development. 2007 May;134(9):1671-7.2007.Epub 2007 Mar 21, PMID:17376808 . Hutchinson, S.A.; Eisen, J.S.: Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity. Development.;133(11):2137-47. 2006. Epub 2006 May 3, PMID:16672347 . Uemura, O.; Okada, Y.; Ando, H.; Guedj, M.; Higashijima, S.; Shimazaki, T.; Chino, N.; Okano, H.; Okamoto, H.: Comparative functional genomics revealed conservation and diversification of three enhancers of the isl1 gene for motor and sensory neuron-specific expression. Dev Biol.;278(2):587-606, 2005. PMID:15680372 .Wan, H.; Korzh, S.; Li, Z.; Mudumana, S.P.; Korzh, V.; Jiang, Y.J.; Lin, S.; Gong, Z.: Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter. Exp. Cell Res. 312(9): 1526-1539, 2006, PMID:16490192 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - MeghnaSingh
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort