Tags:
create new tag
, view all tags

igfbp2a

insulin-like growth factor binding protein 2a

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName igfbp2a
Aliases ENSDARG:ENSDARG00000052470; IGFBP-2, igfbp2a, igfbp2
Description insulin-like growth factor binding protein 2a
GenomicLocation chromosome 6 22605873-22636510 reverse strand
ExternalIDs Entrez:794176; EMBL:AF198033; UniGene:78120; ZFIN:ZDB-GENE-000125-12;
TranscriptID ENSDART:ENSDART00000074327
mRNA NCBI:NM_131458
GeneDescription Insulin-like growth factor binding protein-2 (IGFBP-2) is a secreted protein that binds and regulates IGF actions in controlling growth, development, reproduction, and aging. Elevated expression of IGFBP-2 is often associated with progression of many types of cancers.
GeneFunction Duan et al. (1999) reported the complete primary sequence of a zebrafish IGFBP deduced from cDNA clones. They showed that zebrafish IGFBP-2 is a negative growth regulator acting downstream in the growth hormone-IGF-I axis. Chen et al. (2005) showed that IGFBP-2 plays an important role in the regulation of IGF's action and endocrinology in fish. They investigated the in vivo actions of the IGFBP-2 promoter on developmental stage expression. They reported that the IGFBP-2 promoter-driven GFP transcripts appeared for the first time in the 32-cell stage. They suggested that the IGFBP-2 promoter is active in a development-specific manner and plays an important role in teleost embryo growth. Wood et al. (2005) showed that during early embryonic development IGFBP-2 mRNA is expressed in lens epithelium and cranial boundary regions & becomes localized to the liver by the completion of embryogenesis. They reported that targeted knock-down of IGFBP-2 resulted in delayed development, reduced body growth, IGF-I mRNA levels & disruptions to cardiovascular development. They further reported that IGFBP-2 is required for general embryonic development & growth & plays a local role in regulating vascular development in a model vertebrate organism. Duan et al. (2005) suggested that IGF signaling system plays a fundamental role in regulating embryonic growth, differentiation & in maintaining homeostasis in the adults. Russo et al. (2005) reported that there is a key role for the HBD of IGFBP-2 in the control and regulation of neuroblastoma growth and invasion. Zhou et al. (2008) reported the identification and characterization of two IGFBP-2 genes in zebrafish and four other teleost fish. They suggested that they are co-orthologs of the human IGFBP-2 gene. They showed that both zebrafish igfbp-2a and -2b encode secreted proteins that bind IGFs & exhibit distinct spatiotemporal expression patterns.
GeneCloning Igfbp2 is contained in the BAC clone named CH211-2K18 (Library: CHORI-211, Vector: pTARBAC2.1)
GeneStructure The gene encodes one transcript. The transcript ENSDART00000074327 consists of 4 exons and is 1,768 bps in length. The protein (ENSDARP00000068816) product consists of 276 residues.
Protein ENSDARP00000068816
ProteinDomainandFamilies has domain InterPro:IPR000716; InterPro:IPR000867; InterPro:IPR002048; InterPro:IPR009168; InterPro:IPR012210; InterPro:IPR017891
Motifs has motif Prosite:PS00018; Prosite:PS00222; Prosite:PS00484; PFAM:PF00086; PFAM:PF00219;
Expression ArrayExpress:ENSDARG00000052470;
GeneOntology GO:0005576; GO:0005786; GO:0001558; GO:0001525; GO:0040007; GO:0007507; GO:0009968; GO:0040015; GO:0008285; GO:0005520;
Orthologs Entrez:3485
VariationAndRepeats RSID:rs41114475; RSID:rs41061129
DisordersAndMutations Russo et al. (2005) showed that overexpression of RGE mutant of IGFBP-2 potently promoted SHEP cell proliferation enhancing SHEP cell migration/invasion through the ECM. Morpholino MO1-igfbp2b (5' - GTCTAAAAATCGGAGGACTAGCTTGT - 3') was directed against the gene igfbp2. This is a translation blocking morpholino targeting the igfbp2 gene. Morpholino MO2-igfbp2b (5' - GTGTCCACGATATAAAAGGTCTAAA - 3') was also directed against the gene igfbp2. This is a translation blocking morpholino that targets the igfbp2 gene.
RelatedPubMedArticles Chen, J.Y.; Chou, M.J.; Gong, H.Y.; Huang, T.C.; Wu, J.L.; Kuo, C.M.: Cloning and biological analysis of the zebrafish (Danio rerio) insulin-like growth factor binding protein-2 proximal promoter region. DNA Cell Biol. 2005 Mar; 24(3):199-208.PMID:15767786. Wood, A.W.; Schlueter, P.J.; Duan, C.: Targeted knockdown of insulin-like growth factor binding protein-2 disrupts cardiovascular development in zebrafish embryos. Mol Endocrinol. 2005 Apr; 19(4):1024-34. PMID:15618288 .Duan, C.; Ding, J.; Li, Q.; Tsai, W.; Pozios, K.: Insulin-like growth factor binding protein 2 is a growth inhibitory protein conserved in zebrafish. Proc Natl Acad Sci U S A. 1999 Dec 21; 96(26):15274-9. PMID:10611375 . Zhou, J.; Li, W.; Kamei, H.; Duan, C.: Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence. PLoS ONE.2008;3(12):e3926. PMID:19081843 .Duan, C.; Xu, Q.: Roles of insulin-like growth factor (IGF) binding proteins in regulating IGF actions. Gen Comp Endocrinol. 2005 May 15;142(1-2):44-52. PMID:15862547 .Russo, V.C.; Schütt, B.S.; Andaloro, E.; Ymer, S.I.; Hoeflich, A.; Ranke, M.B.; Bach, L.A.; Werther, G.A.: Insulin-like growth factor binding protein-2 binding to extracellular matrix plays a critical role in neuroblastoma cell proliferation, migration, and invasion. Endocrinology. 2005 Oct;146(10):4445-55. PMID:15994346. NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-06-26 - MeghnaSingh
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort