Tags:
create new tag
, view all tags

hoxa13b

homeo box A13b

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName hoxa13b
Aliases ENSDARG:ENSDARG00000036254; wu:fa66g07, Hoxa-13, zgc:110514
Description homeo box A13b
GenomicLocation chromosome 16 22980334-22982266 forward strand
ExternalIDs Entrez:30438; EMBL:AF071242; UniGene:15718; ZFIN:ZDB-GENE-980526-365;
TranscriptID ENSDART:ENSDART00000052662
mRNA NCBI:NM_131194
GeneDescription Sordino et al 1996 analyzed the structural organization and expression of Abd-B related zebrafish HoxA cluster genes Hoxa-13, found that the genomic organization of Hoxa genes in fish resembles that of tetrapods albeit intergenic distances are shorter.
GeneFunction Geraudie et al 2003 reported the correlation between hoxa gene expression and dermal bone cell differentiation. Expression of two zebrafish developmental posterior hoxa genes, hoxa11b and hoxa13b, was studied by in situ hybridization during pectoral and caudal fin development and regeneration. Expression was restricted to cells of the bony rays region. During fin development, molecular cytological analysis revealed that a subpopulation of mesenchymal cells expressed these two hoax genes during their early differentiation in the subapical region of the developing ray.
GeneCloning The gene is contained in BAC clone DKEY-45E15 (Vector: pIndigoBAC-536).
GeneStructure The gene encodes for a single transcript ENSDART00000052662 which consists of 2 exons and is 1546 bps in length. The protein product (ENSDARP00000052661) consists of 289 residues.
Protein ENSDARP00000052661
ProteinDomainandFamilies has domain InterPro:IPR001356; InterPro:IPR009057; InterPro:IPR017970; InterPro:IPR022067
Motifs has motif Prosite:PS00027; Prosite:PS50071; PFAM:PF00046; PFAM:PF12284
Expression ArrayExpress:ENSDARG00000036254;
GeneOntology GO:0005634; GO:0006355; GO:0045449; GO:0006350; GO:0031564; GO:0006353; GO:0043565; GO:0003677; GO:0003700;
Orthologs Entrez:3209;
VariationAndRepeats RSID:rs179744367; RSID:rs179744368; RSID:rs180100747; RSID:rs180100748; RSID:rs180100749; RSID:rs41128146
DisordersAndMutations The sequence of morpholino MO1-hoxa13b is : 5' - AGCACGCCCTACATGGAGCCCAGCA - 3' . The genotype is: ZFINID:ZDB-GENO-120131-43; ZFINID:ZDB-GENO-080610-8
RelatedPubMedArticles Géraudie J, Borday Birraux V.Posterior hoxa genes expression during zebrafish bony fin ray development and regeneration suggests their involvement in scleroblast differentiation. Dev Genes Evol. 2003 May;213(4):182-6. Epub 2003 Mar 27. PMID:12684773 .Sordino P, Duboule D, Kondo T.Zebrafish Hoxa and Evx-2 genes: cloning, developmental expression and implications for the functional evolution of posterior Hox genes. Mech Dev. 1996 Oct; 59(2):165-75. PMID:8951794 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-28 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort