Tags:
create new tag
, view all tags

hoxa13a

homeo box A13a

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName hoxa13a
Aliases ENSDARG:ENSDARG00000007609
Description homeo box A13a
GenomicLocation chromosome 19 19195251-19197036 forward strand
ExternalIDs Entrez:570239; EMBL:BC133882; UniGene:90248; ZFIN:ZDB-GENE-990415-5;
TranscriptID ENSDART:ENSDART00000026989
mRNA NCBI:NM_001085494
GeneDescription HOX genes specify cell fate in the anterior-posterior axis of animal embryos. Invertebrate chordates have one HOX cluster, but mammals have four, suggesting that cluster duplication facilitated the evolution of vertebrate body plans. Amores et al 1998 reported the existence of seven hox clusters in zebrafish.
GeneFunction Chiu et al 2001 examined how Hox cluster duplication may influence changes in cluster architecture and patterns of noncoding sequence evolution. Chiu et al 2001 sequenced entire duplicated HoxAa and HoxAb clusters of zebrafish (Danio rerio) containing the hoxa13 as well as intergenic and flanking noncoding sequences. These are putative cis-regulatory elements that may play a role in the regulation of the ancestral HoxA cluster. In contrast, homologous regions of the duplicated HoxAa and HoxAb clusters of zebrafish and the HoxA cluster of striped bass revealed a striking loss of conservation of these putative cisregulatory sequences in the 3_ (anterior) segment of the cluster, where zebrafish only retains single representatives of group 1, 3, 4, and 5 (HoxAa) and group 2 (HoxAb) genes and in the 5_ part of the clusters, where zebrafish retains two copies of the group 13, 11, and 9 genes, i.e., AbdB-like genes.
GeneCloning The gene is contained in BAC clone DKEY-25E11 (Vector: pIndigoBAC-536).
GeneStructure The gene encodes for a single transcript ENSDART00000026989 which consists 2 exons and is 1669 bps in length. The protein product (ENSDARP00000003928) consisit of 310 residues.
Protein ENSDARP00000003928
ProteinDomainandFamilies has domain InterPro:IPR001356; InterPro:IPR009057; InterPro:IPR017970; InterPro:IPR022067
Motifs has motif Prosite:PS00027; Prosite:PS50071; PFAM:PF00046; PFAM:PF12284
Expression ArrayExpress:ENSDARG00000007609;
GeneOntology GO:0005634; GO:0006355; GO:0045449; GO:0006353; GO:0006350; GO:0031564; GO:0003677; GO:0003700; GO:0043565;
Orthologs Entrez:3209;
VariationAndRepeats RSID:rs179736624; RSID:rs179736626; RSID:rs180080495
DisordersAndMutations The morpholino MO1-hoxa13a sequence is: 5' - GGCGGAGAAGTAGTGACGTTGTCAT - 3.
RelatedPubMedArticles Amores A, Force A, Yan YL, Joly L, Amemiya C, Fritz A, Ho RK, Langeland J, Prince V, Wang YL, Westerfield M, Ekker M, Postlethwait JH.Zebrafish hox clusters and vertebrate genome evolution. Science. 1998 Nov 27;282(5394):1711-4. PMID:9831563 .Chiu CH, Amemiya C, Dewar K, Kim CB, Ruddle FH, Wagner GP.Molecular evolution of the HoxA cluster in the three major gnathostome lineages. Proc Natl Acad Sci U S A. 2002 Apr 16;99(8):5492-7. Epub 2002 Apr 9. PMID:11943847 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort