Tags:
create new tag
, view all tags

Hgfb

hepatocyte growth factor b

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName Hgfb
Aliases ENSDARG:ENSDARG00000063316; hgf2; hgfb
Description hepatocyte growth factor b
GenomicLocation chromosome 18 9365832-9400048 reverse strand
ExternalIDs Entrez:493782; UniGene:92924; ZFIN:ZDB-GENE-041014-3;
TranscriptID ENSDART:ENSDART00000092421
mRNA NCBI:XM_001921459.1
GeneDescription Hgfb is a member of hepatocyte growth factor and is expressed during fin myoblast migration.
GeneFunction Haines et al. (2004) identified zebrafish orthologs of met and hgf, and examined their expression during fin myoblast migration. Two genes encoding Hgf, termed hgf1 and hgf2 were isolated by them and their expression profiles were analysed. Hgf expression was found to be initiated broadly and at low level within somites at all axial levels at 22 hpf, with stronger expression evident at somite boundaries. By 30 hpf, hgf transcripts can be detected throughout the fin bud mesenchyme with expression in the fin increasing at 36 and 48 hpf. Latimer et al. (2008) characterized the expression of Zebrafish c-met, hgf1 and hgf2 from cleavage stages through organogenesis. They have also showed detectable levels of hgf1 and hgf2 in pharyngeal arches and swim bladder.
GeneCloning

GeneStructure Hgfb encodes a single transcript ENSDART00000092421 which consists of 9 exons with the transcript length of 1131 bps. The protein product ENSDARP00000086853 consists of 377 residues.
Protein ENSDARP00000086853]
ProteinDomainandFamilies has domain InterPro:IPR009003; InterPro:IPR001254;
Motifs has motif PFAM:PF00089;
Expression ArrayExpress:ENSDARG00000063316;
GeneOntology GO:0004252; GO:0006508;
Orthologs Entrez:3082;
VariationAndRepeats RSID:rs180081185; RSID:rs180081202; RSID:rs180055077; RSID:rs180055078; RSID:rs180055079; RSID:rs180055080; RSID:rs180055081; RSID:rs180055085; RSID:rs180055082; RSID:rs180055083; RSID:rs180124570; RSID:rs180124574; RSID:rs180055084; RSID:rs180055086; RSID:rs180055087
DisordersAndMutations The morpholino sequence for the hgfb gene is MO1: 5' - CTGGTAAACAATAAACTCACCCTCC - 3'.
RelatedPubMedArticles Haines, L.; Neyt, C.; Gautier, P.; Keenan, D. G.; Bryson-Richardson, R. J.; Hollway, G. E.; Cole, N. J.; Currie, P. D.: Met and Hgf signaling controls hypaxial muscle and lateral line development in the zebrafish. Development. 2004 Oct;131(19):4857-69. Epub 2004 Sep 1. PMID:15342468 Latimer, A. J.; Jessen, J. R.: Hgf/c-met expression and functional analysis during zebrafish embryogenesis. Dev Dyn. 2008 Dec;237(12):3904-15. PMID:19035351 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-20 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort