Tags:
create new tag
, view all tags

Hgfa

hepatocyte growth factor a

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName Hgfa
Aliases ENSDARG:ENSDARG00000045544; hgf1; si:dkey-146j3.2; hgfa
Description hepatocyte growth factor a
GenomicLocation chromosome 4 18645067-18676721 reverse strand
ExternalIDs Entrez:493781; EMBL:BC135005; UniGene:91265; ZFIN:ZDB-GENE-041014-2;
TranscriptID ENSDART:ENSDART00000066964; ENSDART:ENSDART00000100952
mRNA NCBI:NM_001013274
GeneDescription Hgfa is a homolog of hepatocyte growth factor. HGF and its receptor tyrosine kinase Met are linked to several processes underling vertebrate development and cancer progression.
GeneFunction Haines et al. (2004) identified zebrafish orthologs of met and hgf, and examined their expression during fin myoblast migration. Hgf expression initiates broadly and at low level within somites at all axial levels at 22 hpf, with stronger expression evident at somite boundaries. By 30 hpf, hgf transcripts can be detected throughout the fin bud mesenchyme with expression in the fin increasing at 36 and 48 hpf. Latimer et al. (2008) characterized the expression of Zebrafish c-met, hgf1 and hgf2 from cleavage stages through organogenesis and initiated an analysis of met signalling. During gastrulation, hfg1 transcripts were visible in mesendodermal cells along the midline. They have also showed the transcription of hgf1 during gastrulation while hgf1 and hgf2 are detectable in pharyngeal arches and swim bladder.
GeneCloning The gene is contained in BAC clone DKEY-146J3 (Vector: pIndigoBAC-536).
GeneStructure Hgfa encodes for two transcripts.The novel transcript ENSDART00000066964 consists of 18 exons with the transcript length of 3594 bps. The protein product ENSDARP00000066963 consists of 712 residues.The transcript ENSDART00000100952 consists of 17 exons with the transcript length of 2249 bps. The protein product ENSDARP00000091725 consists of 699 residues.
Protein ENSDARP00000066963 ENSDARP00000091725
ProteinDomainandFamilies has domain InterPro:IPR024174; InterPro:IPR018056; InterPro:IPR013806; InterPro:IPR009003; InterPro:IPR001314; InterPro:IPR000001; InterPro:IPR003014; InterPro:IPR001254; InterPro:IPR003609;
Motifs has motif PFAM:PF00089; PFAM:PF00051; PFAM:PF00024; Prosite:PS50948; Prosite:PS50240; Prosite:PS50070; Prosite:PS00021;
Expression ArrayExpress:ENSDARG00000045544;
GeneOntology GO:0004252; GO:0006508;
Orthologs Entrez:3082;
VariationAndRepeats RSID:rs40635634; RSID:rs40903477;
DisordersAndMutations The morpholino sequence for the hgfa gene is MO1: 5' - CATCCACATAATGTCCGATCTCATG - 3' MO2: 5' - AGATGAGGTGATGTCTTACCATCTG - 3'
RelatedPubMedArticles Haines, L.; Neyt, C.; Gautier, P.; Keenan, D. G.; Bryson-Richardson, R. J.; Hollway, G. E.; Cole, N. J.; Currie, P. D.: Met and Hgf signaling controls hypaxial muscle and lateral line development in the zebrafish. Development. 2004 Oct;131(19):4857-69. Epub 2004 Sep 1. PMID:15342468 Latimer, A. J.; Jessen, J. R.: Hgf/c-met expression and functional analysis during zebrafish embryogenesis. Dev Dyn. 2008 Dec;237(12):3904-15. PMID:19035351 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort