Tags:
create new tag
, view all tags

her1

hairy-related 1

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName her1
Aliases ENSDARG:ENSDARG00000014722; etID309753.5(1) , id:ibd5086
Description hairy-related 1
GenomicLocation chromosome 5 71693373-71700454 reverse strand
ExternalIDs Entrez:30287; UniGene:1462; ZFIN:ZDB-GENE-980526-125;
TranscriptID ENSDART:ENSDART00000016307; ENSDART:ENSDART00000121426
mRNA NCBI:NM_131078
GeneDescription Her1 is a zebrafish hairy-E(spl) homologue that is expanded in a pair-rule like pattern within the presomitic mesoderm (Muller et al.,1996). This expression suggests a role for her1 in formation and/or differentiation of somites.
GeneFunction Gajewski et al., 2003 found that her1 is required to propagate the cyclic expression in the intermediate and anterior PSM. Reporter gene constructs with the her1 upstream sequence driving green fluorescent protein (GFP) expression show that separable regulatory regions can be identified that mediate expression in the posterior versus intermediate and anterior PSM. Lewis et al., 2003 descried that direct autorepression of her1 and her7 by their own protein products provides a mechanism for the intracellular oscillator, by mathematical simulation. They also described that through its coupling to her1/her7 expression, Notch signaling can keep the rapid oscillations in adjacent cells synchronized. Kawamura et al.,2005 showed that Her1 protein represses expression from its own promoter in a cell culture assay. He had also shown that Her13.2 augments autorepression of her1 in association with Her1 protein. Giudicelli et al ., 2007 described a negative feedback loop in somitogenesis, in which the products of two Notch target, her1 and her7, directly inhibit their own transcription, as well as that of the gene for the Nocth ligand DeltaC.
GeneCloning It is contained in the clones MGC:193878 (Vector: pCR4-TOPO reverse) and CH211-283H6 (Vector: pTARBAC2.1)
GeneStructure It codes for two transcripts. Transcript ENSDART00000016307 consists of 4 exons with the transcript length of 1780 bps. The protein product ENSDARP00000027076 of 328 residues. Transcript ENSDART00000121426 consists of 5 exons with the transcript length of 201 bps. The protein product ENSDARP00000107111 of 67 residues
Protein ENSDARP00000027076 ENSDARP00000107111
ProteinDomainandFamilies has domain InterPro:IPR011598; InterPro:IPR003650;
Motifs has motif Prosite:PS50888; Prosite:PS51054; PFAM:PF00010; PFAM:PF07527; UniProt:A3KQ56
Expression ArrayExpress:ENSDARG00000014722;
GeneOntology GO:0005634; GO:0005667; GO:0006355; GO:0045449; GO:0001756; GO:0045892; GO:0003677; GO:0030528; GO:0016564; GO:0046982;
Orthologs Entrez:84667;
VariationAndRepeats RSID:rs180173460; RSID:rs179670442; RSID:rs179670328; RSID:rs179670503; RSID:rs179670355; RSID:rs179670509; RSID:rs41193630; RSID:rs40806571; RSID:rs180173461; RSID:rs179670473; RSID:rs179670343; RSID:rs179670413; RSID:rs179670474; RSID:rs179670335; RSID:rs179670475; RSID:rs40877047; RSID:rs40763689; RSID:rs41227369; RSID:rs40686617; RSID:rs40613678; RSID:rs41087831; RSID:rs40722891; RSID:rs40904777; RSID:rs40981044; RSID:rs40755755; RSID:rs41218557; RSID:rs40738680; RSID:rs41196444; RSID:rs40862795; RSID:rs41147849; RSID:rs41127654; RSID:rs40635075; RSID:rs41055592; RSID:rs40679127; RSID:rs41099200; RSID:rs40665236; RSID:rs40635545; RSID:rs40635080; RSID:rs40635081; RSID:rs40682371; RSID:rs40903064; RSID:rs40665243; RSID:rs40664707; RSID:rs40635083; RSID:rs40665241; RSID:rs40665242; RSID:rs40664712; RSID:rs40634603; RSID:rs40635079; RSID:rs40634594; RSID:rs40634595; RSID:rs40614698; RSID:rs40987438; RSID:rs40641467; RSID:rs40915733; RSID:rs41144157; RSID:rs41028632; RSID:rs40841589; RSID:rs41029699; RSID:rs40815456; RSID:rs40664713; RSID:rs40852148; RSID:rs40665731; RSID:rs40603209; RSID:rs40665234; RSID:rs40878385; RSID:rs40967209; RSID:rs40665729; RSID:rs40665726; RSID:rs40634600; RSID:rs40664710; RSID:rs40665239; RSID:rs40665733; RSID:rs40867940; RSID:rs40666254; RSID:rs41215831; RSID:rs41091576; RSID:rs40791995; RSID:rs40665730; RSID:rs40665728; RSID:rs40664705; RSID:rs40634602; RSID:rs40635076; RSID:rs40755937; RSID:rs41208005; RSID:rs40856990; RSID:rs40709606; RSID:rs40665235; RSID:rs179670458; RSID:rs179670327; RSID:rs179670383; RSID:rs179670342; RSID:rs179670376; RSID:rs179670492; RSID:rs179670412; RSID:rs179670352; RSID:rs179670465; RSID:rs179670325; RSID:rs179670334; RSID:rs179670467; RSID:rs179670537; RSID:rs179670350; RSID:rs179670398; RSID:rs179670440; RSID:rs179670394; RSID:rs179670432; RSID:rs179670483; RSID:rs40864905; RSID:rs179670538; RSID:rs179670481; RSID:rs179670521; RSID:rs179670341; RSID:rs179670329; RSID:rs40768746; RSID:rs179670388; RSID:rs179670524; RSID:rs179670469; RSID:rs179670448; RSID:rs179670486; RSID:rs179670528; RSID:rs179670349; RSID:rs179670516; RSID:rs179670429; RSID:rs179670411; RSID:rs179670374; RSID:rs179670363; RSID:rs179670365; RSID:rs179670480; RSID:rs41218887; RSID:rs40747653; RSID:rs40710470; RSID:rs41115747; RSID:rs41204425; RSID:rs180173462; RSID:rs180173463;
DisordersAndMutations Morpholinos MO1-her1 (5' - TTCGACTTGCCATTTTTGGAGTAAC - 3') , MO2-her1 (5'-AGTATTGTATTCCCGCTGATCTGTC - 3') , MO3-her1 (5' - CATGGCTGAAAATCGGAAGAAGACG - 3') , MO4-her1 (5' - CGACTTGCCATTTTTGGAGTAACCA - 3'), MO5-her1 (5' - GACTTGCCATTTTTGGAGTAACCAT - 3'), MO6-her1 - ( 5' - ACACCTTCAGTATTGTATTCCCGCT - 3')
RelatedPubMedArticles Giudicelli F, Ozbudak EM, Wright GJ, Lewis J.Setting the tempo in development: an investigation of the zebrafish somite clock mechanism. PLoS Biol. 2007 Jun;5(6):e150. PMID:17535112 Lewis J. Autoinhibition with transcriptional delay: a simple mechanism for the zebrafish somitogenesis oscillator.Curr Biol. 2003 Aug 19;13(16):1398-408. PMID:12932323 Gajewski M, Sieger D, Alt B, Leve C, Hans S, Wolff C, Rohr KB, Tautz D.Anterior and posterior waves of cyclic her1 gene expression are differentially regulated in the presomitic mesoderm of zebrafish. Development PMID:12900444 Sieger D, Ackermann B, Winkler C, Tautz D, Gajewski M.her1 and her13.2 are jointly required for somitic border specification along the entire axis of the fish embryo. Dev Biol. 2006 May 1;293(1):242-51. PMID:16545363 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort