Tags:
create new tag
, view all tags

hdac3

histone deacetylase 3

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName hdac3
Aliases ENSDARG:ENSDARG00000037514; Histone deacetylase 3 (HD3).
Description histone deacetylase 3
GenomicLocation chromosome 14 12437128-12464078 forward strand
ExternalIDs Entrez:393965; EMBL:BC044543; UniGene:80607; ZFIN:ZDB-GENE-040426-847;
TranscriptID ENSDART:ENSDART00000054626; ENSDART:ENSDART00000145250
mRNA NCBI:NM_200990
GeneDescription The protein encoded by hdac3 gene belongs to the histone deacetylase family. It has histone deacetylase activity and represses transcription.
GeneFunction Hdac3 gene encodes for a single transcript ENSDART00000054626 which consists of 15 exons with the transcript length of 2,050 bps. The protein product ENSDARP00000054625 consists of 428 residues.
GeneCloning The gene is contained in BAC clone CH211-194M19 (Vector: pTARBAC2.1).
GeneStructure Farooq et al. (2008) chemically inhibited hdac by valproic acid (VPA) which led to impaired liver development in Zebrafish mainly by inhibiting specification, budding, and differentiation. The liver defects induced by VPA correlated with suppressed total hdac enzymatic activity, but are independent of angiogenesis inhibition. Overexpression of hdac3 partially rescued VPA induced small liver.
Protein ENSDARP00000054625
ProteinDomainandFamilies has domain InterPro:IPR000286; InterPro:IPR003084;
Motifs has motif PFAM:PF00850; PRINTS:PR01270; PRINTS:PR01271;
Expression ArrayExpress:ENSDARG00000037514;
GeneOntology GO:0005634; GO:0016575; GO:0004407;
Orthologs

VariationAndRepeats RSID:rs40612016; RSID:rs40619147; RSID:rs40604669; RSID:rs40653466; RSID:rs40635178; RSID:rs40635181; RSID:rs40653469; RSID:rs40635182; RSID:rs41232398; RSID:rs40600840; RSID:rs180085312; RSID:rs40613435; RSID:rs40625903; RSID:rs40628295; RSID:rs40594043; RSID:rs41171011; RSID:rs40628307; RSID:rs40606056; RSID:rs40971783; RSID:rs40614116; RSID:rs40606778; RSID:rs41073027; RSID:rs41110268; RSID:rs40614590; RSID:rs40600247; RSID:rs40622325; RSID:rs40910177; RSID:rs40647886; RSID:rs41056691; RSID:rs40594130; RSID:rs40904010; RSID:rs40879933; RSID:rs40620448; RSID:rs40602136; RSID:rs40618669; RSID:rs40985743; RSID:rs40910600; RSID:rs40887078; RSID:rs40598494; RSID:rs41052136; RSID:rs40619167; RSID:rs40594758; RSID:rs40625666; RSID:rs40606416; RSID:rs40616945; RSID:rs40662278; RSID:rs40601996; RSID:rs40609069; RSID:rs40617294; RSID:rs40959964; RSID:rs41120118; RSID:rs40852510; RSID:rs40680798; RSID:rs41237438; RSID:rs41082445; RSID:rs40894972; RSID:rs40934193; RSID:rs40894454; RSID:rs40855242; RSID:rs41000502; RSID:rs40891469; RSID:rs40729328; RSID:rs41044661; RSID:rs41055718; RSID:rs40914522; RSID:rs41064379; RSID:rs40786312; RSID:rs40850647; RSID:rs40962304; RSID:rs40935974; RSID:rs41121292; RSID:rs40911593; RSID:rs40679771; RSID:rs41106431; RSID:rs40978820; RSID:rs40684794; RSID:rs41212668; RSID:rs40723469; RSID:rs40708312; RSID:rs40604966; RSID:rs40598918; RSID:rs40627040; RSID:rs40623087; RSID:rs40626140; RSID:rs40621325; RSID:rs40608454; RSID:rs40619045; RSID:rs40596230; RSID:rs40594756; RSID:rs40627504; RSID:rs40624585; RSID:rs40622510; RSID:rs40617775; RSID:rs40784227; RSID:rs40828290; RSID:rs41045809; RSID:rs40601878; RSID:rs40625085; RSID:rs40604873; RSID:rs40610947; RSID:rs40595286; RSID:rs40619513; RSID:rs40611124; RSID:rs40628970; RSID:rs40611280; RSID:rs40612702; RSID:rs40615032; RSID:rs40626997; RSID:rs40596748; RSID:rs40605116; RSID:rs40615552; RSID:rs40623899; RSID:rs40628944; RSID:rs40619992; RSID:rs40596901; RSID:rs40619007; RSID:rs40602522; RSID:rs40616099; RSID:rs40625049; RSID:rs40626350; RSID:rs40622738; RSID:rs40628193; RSID:rs40600000; RSID:rs40600880; RSID:rs40626875; RSID:rs40600954; RSID:rs40620395; RSID:rs40602998; RSID:rs40627166; RSID:rs40627135; RSID:rs40603185; RSID:rs40602669; RSID:rs40598428; RSID:rs40618473; RSID:rs40619270; RSID:rs40596780; RSID:rs40612707; RSID:rs40609198; RSID:rs40629251; RSID:rs40604497; RSID:rs40603052; RSID:rs40592203; RSID:rs40611141; RSID:rs40619534; RSID:rs40592603; RSID:rs40608373; RSID:rs40618339; RSID:rs40606797; RSID:rs40623138; RSID:rs40617901; RSID:rs40905887; RSID:rs40933491; RSID:rs40649053; RSID:rs40977549; RSID:rs41074965; RSID:rs40954483; RSID:rs41098639; RSID:rs41109998; RSID:rs40726734; RSID:rs41038016; RSID:rs41000250; RSID:rs40622106; RSID:rs40604337; RSID:rs40627860; RSID:rs40625160; RSID:rs40628802; RSID:rs40618794; RSID:rs40610998; RSID:rs40626314; RSID:rs40653467; RSID:rs40687169; RSID:rs40953435; RSID:rs40704185; RSID:rs40615814; RSID:rs40622311; RSID:rs40611217; RSID:rs40621932; RSID:rs40906499; RSID:rs40609077; RSID:rs40937188; RSID:rs40779494; RSID:rs40595961; RSID:rs40606768; RSID:rs40613120; RSID:rs40603995; RSID:rs40936714; RSID:rs40926501; RSID:rs40790741; RSID:rs40839619; RSID:rs40801619; RSID:rs41019242; RSID:rs40971151; RSID:rs41203053; RSID:rs40881130; RSID:rs41209842; RSID:rs41113923; RSID:rs40721404; RSID:rs41120085; RSID:rs40786629; RSID:rs41141148; RSID:rs40859424; RSID:rs40689721; RSID:rs40749080; RSID:rs40789877; RSID:rs40604014; RSID:rs40627725; RSID:rs40609984; RSID:rs40616744; RSID:rs40599045; RSID:rs40626132; RSID:rs40624521; RSID:rs40992015; RSID:rs40702096; RSID:rs41036325; RSID:rs40854831; RSID:rs40762114; RSID:rs41096882; RSID:rs40863152; RSID:rs41171247; RSID:rs41031693; RSID:rs40872719; RSID:rs40616654; RSID:rs40597504; RSID:rs41071501; RSID:rs40678501; RSID:rs40611247; RSID:rs40597418; RSID:rs40613268; RSID:rs40621163; RSID:rs40624372; RSID:rs40621488; RSID:rs40605236; RSID:rs40622759; RSID:rs40600892; RSID:rs40745281; RSID:rs40597633; RSID:rs41218252; RSID:rs40610993; RSID:rs40609157; RSID:rs40617452; RSID:rs40603795; RSID:rs40595812; RSID:rs40628538; RSID:rs40628903; RSID:rs40602982; RSID:rs41123535; RSID:rs40756602; RSID:rs40621816; RSID:rs40622037; RSID:rs40609969; RSID:rs40878348; RSID:rs40615700; RSID:rs40610068; RSID:rs40620000; RSID:rs40602380; RSID:rs40624792; RSID:rs41073796; RSID:rs40983602; RSID:rs41198336; RSID:rs40600574; RSID:rs40756928; RSID:rs40605437; RSID:rs40607526; RSID:rs40621497; RSID:rs40613884; RSID:rs40599721; RSID:rs40610000; RSID:rs40619817;
DisordersAndMutations Morpholinos MO1-hdac3 ( 5' - CATAGAAGTACGCAGTTCGATTGGT - 3') and MO2-hdac3 ( 5' - GCAGTTATTTCTAGCACGAGAAAC - 3') has been used to knock the hdac3 gene down.
RelatedPubMedArticles Farooq, M.; Sulochana, K. N.; Pan, X.; To, J.; Sheng, D.; Gong, Z.; Ge, R.: Histone deacetylase 3 (hdac3) is specifically required for liver development in zebrafish. Dev Biol. 2008 May 1;317(1):336-53. Epub 2008 Feb 29. PMID:18367159 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort