Tags:
create new tag
, view all tags

hdac1

histone deacetylase 1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName hdac1
Aliases ENSDARG:ENSDARG00000015427; Colgate; col; hdac-1; MGC101582; chunp6919; zgc:65818; wu:fb19h11; wu:fi06f03; zgc:101582; mp:zf637-2-001987; hdac1
Description histone deacetylase 1
GenomicLocation chromosome 19 31054097-31064046 forward strand
ExternalIDs Entrez:192302; EMBL:AF506201; UniGene:31752; ZFIN:ZDB-GENE-020419-32;
TranscriptID ENSDART:ENSDART00000051799; ENSDART:ENSDART00000148935; ENSDART:ENSDART00000149128
mRNA NCBI:NM_173236
GeneDescription The gene codes for a protein - Histone deacetylase1, a critical component of transcriptional silencing mechanisms that regulate embryonic development. It has been shown that histone deacetylase 1 (hdac1) is required for neuronal specification during zebrafish CNS development.
GeneFunction Cunliffe VT et al. (2004) showed that hdac1 is specifically required in the zebrafish embryonic CNS to maintain neurogenesis. He concluded that in the zebrafish embryo, hdac1 is an essential component of the transcriptional silencing machinery that supports the formation and subsequent differentiation of neuronal precursors.Pillai R et al. (2004) showed that histone deacetylase 1 (hdac-1) is expressed throughout embryonic development of the zebrafish. The expression of hdac-1 is ubiquitous in early embryos (2-16 hr postfertilization), but at later stages (36 and 48 hr postfertilization), it is primarily restricted to the branchial arches, fin bud mesenchyme, and hindbrain. They concluded that Histone deacetylase 1 (HDAC-1) is required for the normal formation of craniofacial cartilage and pectoral fins of the zebrafish.Stadler JA et al. (2005) demonstrated that the in vivo role of HDAC1 in regulating cell cycle progression is region-specific, as HDAC1 promotes cell cycle exit in the retina but stimulates proliferation in other cellular contexts.Yamaguchi M et al. (2005) reported that histone deacetylase 1 (Hdac1) is required for the switch from proliferation to differentiation in the zebrafish retina. Their data suggests that Hdac1 antagonizes these pathways to promote cell-cycle exit and the subsequent neurogenesis in zebrafish retina. They further established that Hdac1 functions as a dual switch that suppresses both cell-cycle progression and inhibition of neurogenesis in the zebrafish retina.Cunliffe VT et al. (2006) on the basis of the finding that histone deacetylase 1 (hdac1) is required for neuronal specification during zebrafish CNS development, identified hdac1 as a novel, essential component of the mechanism that allocates neural progenitors to the oligodendrocyte fate, by attenuating expression of a subset of neural progenitor genes and rendering olig2 expression responsive to Hedgehog signalling.Nambiar RM et al. (2007) showed that col normally regulates the caudal migration of nVII facial hindbrain branchiomotor neurons and that the mutant phenotype can be rescued by misexpression of vangl2 independent of the Wnt/PCP pathway.they identified a novel role for zebrafish hdac1 in activating non-canonical Wnt/PCP signaling underlying axial extension and in promoting Wnt-independent caudal migration of a subset of hindbrain branchiomotor neurons.Ignatius MS et al. (2008) showed that hdac1 is normally required to suppress neural crest foxd3 expression thus de-repressing mitfa resulting in melanogenesis by a subset of neural crest-derived cells.
GeneCloning The gene is contained in BAC clone CH73-130A3 (Vector: pTARBAC2.1).
GeneStructure The transcript ENSDART00000051799 consists of 14 exons and is 2242 bps in length. The protein product ENSDARP00000051798 is of 480 residues. The transcript ENSDART00000148935 consists of 10 exons and is 1249 bps in length. No protein product. The transcript ENSDART00000149128 consists of 2 exons and is 849 bps in length. No protein product
Protein ENSDARP00000051798
ProteinDomainandFamilies has domain InterPro:IPR023801; InterPro:IPR003084; InterPro:IPR000286;
Motifs has motif PFAM:PF00850; PRINTS:PR01270; PRINTS:PR01271;
Expression ArrayExpress:ENSDARG00000015427
GeneOntology GO:0005634; GO:0016575; GO:0008285; GO:0050769; GO:0048709; GO:0004407;
Orthologs Entrez:3065;
VariationAndRepeats RSID:rs40657219; RSID:rs40653643; RSID:rs40653642; RSID:rs40641754; RSID:rs40982642; RSID:rs40914983; RSID:rs40814428; RSID:rs40936021; RSID:rs41162903; RSID:rs41222136;
DisordersAndMutations Colgate (col) mutants of the hdac1 gene display defects in the extension of the body axis and the migration of branchiomotor neurons (Nambiar RM et al. (2007)). They have reduced number of pigment cells, delayed differentiation and decreased migration of neural crest-derived melanophores and their precursors (Ignatius MS et al. (2008)). Specification of oligodendrocytes, the myelinating cells of the CNS, also fails to occur in the hdac1 mutant hindbrain (Cunliffe VT et al. (2004)).Antisense morpholino oligonucleotide targeted to zebrafish HDAC-1 mRNA contains the sequence 5 -TTGTTCCTTGAGAACTCAGCGCCAT-3 .MO2-hdac1 is 5' - ATATTCTTACCGTCATAATAATAGC - 3'. ZFINID:ZDB-GENO-090609-2; ZFINID:ZDB-GENO-071220-28; ZFINID:ZDB-GENO-980202-330; ZFINID:ZDB-GENO-050811-1; ZFINID:ZDB-GENO-100618-5; ZFINID:ZDB-GENO-091103-2; ZFINID:ZDB-GENO-091103-4; ZFINID:ZDB-GENO-050819-4; ZFINID:ZDB-GENO-050819-3; ZFINID:ZDB-GENO-050819-2; ZFINID:ZDB-GENO-080701-1; ZFINID:ZDB-GENO-070209-122; ZFINID:ZDB-GENO-100513-2; ZFINID:ZDB-GENO-090730-5; ZFINID:ZDB-GENO-020426-12; ZFINID:ZDB-GENO-070209-187; ZFINID:ZDB-GENO-040130-3; ZFINID:ZDB-GENO-080804-3; ZFINID:ZDB-GENO-080804-2; ZFINID:ZDB-GENO-110414-4; ZFINID:ZDB-GENO-110414-3; ZFINID:ZDB-GENO-090812-1; ZFINID:ZDB-GENO-091103-3; ZFINID:ZDB-GENO-091103-5;
RelatedPubMedArticles Cunliffe, VT (2004). Histone deacetylase 1 is required to repress Notch target gene expression during zebrafish neurogenesis and to maintain the production of motoneurones in response to hedgehog signalling. Development. 131(12):2983-95. PMID:15169759 .Pillai, R; Coverdale, LE; Dubey, G; Martin, CC (2004). Histone deacetylase 1 (HDAC-1) required for the normal formation of craniofacial cartilage and pectoral fins of the zebrafish. Dev Dyn. 231(3):647-54. PMID:15376317 .Stadler, JA; Shkumatava, A; Norton, WH; Rau, MJ; Geisler, R; Fischer, S; Neumann, CJ (2005). Histone deacetylase 1 is required for cell cycle exit and differentiation in the zebrafish retina. Dev Dyn. 233(3):883-9. PMID:15895391 .Yamaguchi, M; Tonou-Fujimori, N; Komori, A; Maeda, R; Nojima, Y; Li, H; Okamoto, H; Masai, I (2005). Histone deacetylase 1 regulates retinal neurogenesis in zebrafish by suppressing Wnt and Notch signaling pathways. Development. 132(13):3027-43. PMID:15944187 .Cunliffe, VT. (2006). Casaccia-Bonnefil P.Histone deacetylase 1 is essential for oligodendrocyte specification in the zebrafish CNS. Mech Dev. 123(1):24-30. PMID:16324829 . Nambiar, RM; Ignatius, MS; Henion, PD (2007). Zebrafish colgate/hdac1 functions in the non-canonical Wnt pathway during axial extension and in Wnt-independent branchiomotor neuron migration. Mech Dev. 124(9-10):682-98. PMID:17716875 .Ignatius, MS; Moose, HE; El-Hodiri, HM; Henion, PD (2007). colgate/hdac1 Repression of foxd3 expression is required to permit mitfa-dependent melanogenesis. Dev Biol. 313(2):568-83. PMID:18068699 . NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort