Tags:
create new tag
, view all tags

gsk3a

glycogen synthase kinase 3 alpha

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName gsk3a
Aliases ENSDARG:ENSDARG00000015681; GSK3; GSK-3[a]; GSK-3[b]; gsk3a
Description glycogen synthase kinase 3 alpha
GenomicLocation chromosome 16 12946298-12996004 forward strand
ExternalIDs Entrez:30664; EMBL:BC056332; UniGene:75529; ZFIN:ZDB-GENE-990714-3;
TranscriptID ENSDART:ENSDART00000024935; ENSDART:ENSDART00000138335; ENSDART:ENSDART00000111481; ENSDART:ENSDART00000131997;
mRNA NCBI:NM_131390
GeneDescription Tsai et al.(1999) studied the GSK 3 homologue genes .Glycogen synthase kinase 3 (GSK-3) belongs to a highly conserved family of protein serine/threonine kinase whose members in high eukaryotes are involved in hormonal regulation, nuclear signaling, and cell fate determination. Glycogen synthase kinase 3 (GSK3) encodes a serine/threonine protein kinase, known to play roles in many biological processes. Two closely related GSK3 isoforms encoded by distinct genes: GSK3α (51 kDa) and GSK3β (47 kDa)
GeneFunction Lee et al 2003 studied the role of gsk3a in cardiogenesis. GSK3α, but not GSK3β, is necessary in cardiomyocyte survival; and GSK3α and GSK3β play distinct roles during zebrafish cardiogenesis.Tsai et al.(1999) Studied the expression of gsk3a gene. ZGSK-3a was expressed uniformly from cleavage onward, and later was found in many but not all tissues, especially in the central nervous system, spinal cord, somites and pronephric ducts.
GeneCloning The gene is contained in BAC clone DKEY-165G20 (Vector: pIndigoBAC-536).Yoshida et al.(2003) cloned Zebrafish GSK-3a cDNA by PCR using a cDNA library prepared from embryos at 24 hpf to study the neuron specific genes during the development of Zerbafish. Substitution mutations of the amino acid residues 85K and 86K to 85M and 86I were introduced into the cDNA by PCR to yield dnGSK-3β.
GeneStructure gs3ka gene codes for four transcripts. Transcript ENSDART00000024935 consists of 10 exons with the transcript length of 2971 bps. The protein product ENSDARP00000011670 consists of 440 residues. Transcript ENSDART00000111481 consists of 11 exons with the transcript length of 2514 bps. The protein product ENSDARP00000099545 consists of 440 residues. Transcript ENSDART00000138335 consists of 4 exons with the transcript length of 576 bps. The protein product ENSDARP00000114920 consists of 40 residues. Transcript ENSDART00000131997 consists of 4 exons with the transcript length of 901 bps. No protein product.
Protein ENSDARP00000011670 ENSDARP00000114920 ENSDARP00000099545 ENSDARP00000049706 ENSDARP00000076449 ENSDARP00000113115 ENSDARP00000108520
ProteinDomainandFamilies has domain InterPro:IPR011009; InterPro:IPR002290; InterPro:IPR008271; InterPro:IPR000719; InterPro:IPR017441;
Motifs has motif Prosite:PS50011; Prosite:PS00107; Prosite:PS00108; PFAM:PF00069; PRINTS:PR00109;
Expression ArrayExpress:ENSDARG00000015681;
GeneOntology GO:0006468; GO:0005524; GO:0004674; GO:0004672; GO:0016301; GO:0000166; GO:0016740; GO:0055013;GO:0001947;
Orthologs Entrez:2931;
VariationAndRepeats RSID:rs179822907; RSID:rs179822828; RSID:rs179822714; RSID:rs179822792; RSID:rs179823007; RSID:rs180099365; RSID:rs179822843; RSID:rs179822660; RSID:rs41019333; RSID:rs179823004; RSID:rs40885284; RSID:rs179822782; RSID:rs179822797; RSID:rs179822743; RSID:rs179822917; RSID:rs179822674; RSID:rs179822654; RSID:rs179822852; RSID:rs179822970; RSID:rs179822750; RSID:rs179822964; RSID:rs179822934; RSID:rs179822891; RSID:rs179822916; RSID:rs179822881; RSID:rs179822718; RSID:rs179822771; RSID:rs179822705; RSID:rs179822928; RSID:rs179822736; RSID:rs179823024; RSID:rs179822811; RSID:rs179822682; RSID:rs179997674; RSID:rs179822883; RSID:rs179998089; RSID:rs179997985; RSID:rs179997695; RSID:rs179997606; RSID:rs179998067; RSID:rs179997911; RSID:rs179997887; RSID:rs179997613; RSID:rs179997816; RSID:rs179822715; RSID:rs179823032; RSID:rs179822807; RSID:rs179822979; RSID:rs179822751; RSID:rs179822876; RSID:rs179822950; RSID:rs179822680; RSID:rs179822845; RSID:rs179822888; RSID:rs179822905; RSID:rs179822875; RSID:rs179822688; RSID:rs179997706; RSID:rs179997750; RSID:rs40774554; RSID:rs41116964; RSID:rs40701346; RSID:rs41135934; RSID:rs40910004; RSID:rs179822958; RSID:rs179822710; RSID:rs179822780; RSID:rs179822761; RSID:rs179823020; RSID:rs179823034; RSID:rs179822959; RSID:rs179822827; RSID:rs179822846; RSID:rs179822667; RSID:rs179823030; RSID:rs179822754; RSID:rs179822766; RSID:rs179823028; RSID:rs179822655; RSID:rs179822816; RSID:rs179997657; RSID:rs179822687; RSID:rs179822699; RSID:rs179822920; RSID:rs179822886; RSID:rs179822906; RSID:rs179822872; RSID:rs179822947; RSID:rs179822960; RSID:rs179822727; RSID:rs179426367; RSID:rs179426390; RSID:rs179426415; RSID:rs179426292; RSID:rs179426339; RSID:rs180099366; RSID:rs179426402; RSID:rs179426406; RSID:rs179426315; RSID:rs179426335; RSID:rs179426393; RSID:rs179426344; RSID:rs179426325; RSID:rs179426399; RSID:rs179426358; RSID:rs179426313; RSID:rs179426350; RSID:rs179426403; RSID:rs179426304; RSID:rs179426291; RSID:rs179426318; RSID:rs179426372; RSID:rs179426316; RSID:rs179426405; RSID:rs179426412; RSID:rs179426371; RSID:rs179426314; RSID:rs179426293; RSID:rs179426408; RSID:rs179426307; RSID:rs179426361; RSID:rs179426357; RSID:rs179426312; RSID:rs179426331; RSID:rs179426370; RSID:rs179426328; RSID:rs179426379; RSID:rs179426327; RSID:rs179426380; RSID:rs179426356; RSID:rs179426395; RSID:rs179426348; RSID:rs179426352; RSID:rs179426311; RSID:rs179426294; RSID:rs179426381; RSID:rs179426388; RSID:rs179426341; RSID:rs179426382; RSID:rs179426411; RSID:rs179426303; RSID:rs180099367; RSID:rs179426364; RSID:rs179426401; RSID:rs179426300; RSID:rs179426295; RSID:rs179997666; RSID:rs179426368; RSID:rs179426326; RSID:rs179426386; RSID:rs179426338; RSID:rs179426394; RSID:rs179426290; RSID:rs179426297; RSID:rs179426409; RSID:rs179426414; RSID:rs179426384; RSID:rs179426353; RSID:rs179426302; RSID:rs179426349; RSID:rs179426389; RSID:rs179426329; RSID:rs179426366; RSID:rs179426323; RSID:rs179426378; RSID:rs179426306; RSID:rs179426396; RSID:rs179426337; RSID:rs179426301; RSID:rs179426369; RSID:rs179426299; RSID:rs179426365; RSID:rs179426324; RSID:rs179997727; RSID:rs40650613; RSID:rs179426321; RSID:rs179426377; RSID:rs179426354; RSID:rs179426392; RSID:rs179426362; RSID:rs180099368; RSID:rs179426383; RSID:rs179426320; RSID:rs179426398; RSID:rs179426298; RSID:rs179426407; RSID:rs179426351; RSID:rs179426391; RSID:rs180099369; RSID:rs179426343; RSID:rs179426305; RSID:rs179426340; RSID:rs179426397; RSID:rs180099370; RSID:rs179426404; RSID:rs180099371; RSID:rs179426375; RSID:rs179997681; RSID:rs179997598; RSID:rs179426385; RSID:rs179426359; RSID:rs179426319; RSID:rs179426346; RSID:rs179426296; RSID:rs179997871; RSID:rs179426333; RSID:rs179426322; RSID:rs179426317; RSID:rs179426373; RSID:rs179426330; RSID:rs179426400; RSID:rs179426355; RSID:rs179426416; RSID:rs179426387; RSID:rs179426336; RSID:rs179426309; RSID:rs179426376; RSID:rs179426360; RSID:rs179426410; RSID:rs180099372; RSID:rs179426374; RSID:rs179426332; RSID:rs179426334; RSID:rs179426347; RSID:rs180099373; RSID:rs179822767; RSID:rs179822786; RSID:rs179822835; RSID:rs179822901; RSID:rs179822686; RSID:rs179822805; RSID:rs179822671; RSID:rs179822765; RSID:rs180165508; RSID:rs179998009; RSID:rs179997919; RSID:rs180099374; RSID:rs179822793; RSID:rs179822809; RSID:rs179822731; RSID:rs179822673; RSID:rs179822830; RSID:rs179822946; RSID:rs179822840; RSID:rs179822663; RSID:rs179823042; RSID:rs179822669; RSID:rs179822864; RSID:rs179822717; RSID:rs179822802; RSID:rs179822778; RSID:rs179822998; RSID:rs179822713; RSID:rs40786477; RSID:rs41204477; RSID:rs41192256; RSID:rs179822664; RSID:rs179822877; RSID:rs179822851; RSID:rs179822918; RSID:rs179822993; RSID:rs179822977; RSID:rs179822711; RSID:rs179822801; RSID:rs179823025; RSID:rs179822698; RSID:rs179823021; RSID:rs179822650; RSID:rs179822937; RSID:rs179822991; RSID:rs179822740; RSID:rs179822763; RSID:rs179822706; RSID:rs179822865;
DisordersAndMutations Lee et al.(2003) used morpholino to block the translation of gsk3a gene and to study the role in cardiogenesis. Both gsk3α- and gsk3β-MO-injected embryos displayed similar morphological defects, with a thin, string-like shaped heart and pericardial edema at 72 hours post-fertilization. However, when detailed analysis of the gsk3α-and gsk3β-MO-induced heart defects.It was found that the reduced number of cardiomyocytes in gsk3α morphants during the heart-ring stage was due to apoptosis and disrupted the asymmetry pattern in the heart. Finally, the phenotypes of gsk3α mutant embryos cannot be rescued by gsk3β mRNA, and vice versa, demonstrating that GSK3α and GSK3β are not functionally redundant.Lee et al.(2003) used following morpholino antisense oligonucleotides (MOs): gsk3α-MO, CCGCTGCCGCTCATTTCGGGTTGCA; gsk3β-MO, GTTCTGGGCCGACCGGACATTTTTC; standard negative control-MO, CCTCTTACCTCAGTTACAATTTATA.
RelatedPubMedArticles Tsai,J.N.; Lee,C.H.;Jeng,H.;Chi,W.K.;Chang,W.C.:Differential expression of glycogen synthase kinase 3 genes during zebrafish embryogenesis. Mech Dev. 1;91(1-2):387-91,2000. PMID:10704871 Lee,H.C.;Tsai,J.N.;Liao,P.Y.;Tsai,W.Y.;Lin,K.Y.; Chuang,C.C.; Sun,C.K.;Chang,W.C.; Tsai,H.J.:Glycogen synthase kinase 3 alpha and 3 beta have distinct functions during cardiogenesis of zebrafish embryo. BMC Dev Biol;7:93,2007. PMID:17683539 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort