Tags:
create new tag
, view all tags

gli3

GLI-Kruppel family member GLI3

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName gli3
Aliases ENSDARG:ENSDARG00000052131; im:7142603
Description GLI-Kruppel family member GLI3
GenomicLocation chromosome 24 11300478-11593735 reverse strand
ExternalIDs Entrez:403042; EMBL:AY377429; UniGene:99315; ZFIN:ZDB-GENE-041111-162;
TranscriptID ENSDART:ENSDART00000123554; ENSDART:ENSDART00000058992
mRNA NCBI:NM_205728
GeneDescription Gli transcription factors (Gli1, Gli2 & Gli3) mainly involved in Hedgehog (Hh) signaling path way which regulates cell differentiation and patterning in a wide variety of embryonic tissues.Gli3 is plays important role in Hedgehog signaling pathway, it also an important component of Hedgehog signaling pathway (Tyurina et al 2004).
GeneFunction Tyurina et al 2004 addressed the question of whether Gli3 function has also diverged in zebrafish and analyzed the regulatory interactions between Hh signaling and Gli activity and found that zebrafish Gli3 has an early function as an activator of Hh target genes that overlaps with Gli1 activator function in the ventral neural tube. In vitro reporter analysis showed that Gli3 cooperates with Gli1 to activate transcription in the presence of high concentrations of Hh. During late somitogenesis stages, Gli3 is required as a repressor of the Hh response. Gli3 shares this repressor activity with Gli2 in the dorsal spinal cord, hindbrain, and midbrain, but not in the forebrain. Consistently, zebrafish Gli3 blocks Gli1-mediated activation of a reporter gene in the absence of Hh in vitro. In the eye, Gli3 is also required for proper ath5 expression and the differentiation of retinal ganglion cells (RGCs).Hadzhiev et al 2007 studied the expression of gli3 gene in Zebrafish caudal fin primordium.
GeneCloning The gene is contained in, BAC clone CH73-105F15 (Vector: pTARBAC2), BAC clone CH211-281G2 (Vector: pTARBAC2.1), BAC clone DKEY-90P8 (Vector: pIndigoBAC-536), BAC clone DKEY-149L16 (Vector: pIndigoBAC-536), FOSMID clone CH1073-45O15 (Vector: pCC1FOS-CHA_PmII), FOSMID clone CH1073-328K10 (Vector: pCC1FOS-CHA_PmII).
GeneStructure This gene encodes two transcripts Transcript ENSDART00000058992 which consists of 15 exons and is 6688 bps in length. The protein product ENSDARP00000058991 consists of 1,553 residues. Transcript ENSDART00000123554 which consists of 14 exons and is 6325 bps in length. The protein product ENSDARP00000110429 consists of 1,553 residues.
Protein ENSDARP00000110429 ENSDARP00000058991
ProteinDomainandFamilies has domain InterPro:IPR013087; InterPro:IPR015880; InterPro:IPR007087;
Motifs has motif Prosite:PS00028; Prosite:PS50157; PFAM:PF00096;
Expression ArrayExpress:ENSDARG00000052131;
GeneOntology GO:0005622; GO:0045449; GO:0050767; GO:0048699; GO:0008270; GO:0003676; GO:0003677;
Orthologs Entrez:2737;
VariationAndRepeats RSID:rs180059609; RSID:rs180059610; RSID:rs180059612; RSID:rs180059613; RSID:rs180059614; RSID:rs179474538; RSID:rs179474530; RSID:rs179474522; RSID:rs179474496; RSID:rs179474539; RSID:rs179474472; RSID:rs180059615; RSID:rs180059616; RSID:rs180059617; RSID:rs180059618; RSID:rs180059619; RSID:rs180059620; RSID:rs180059621; RSID:rs180059622; RSID:rs180059623; RSID:rs180059624; RSID:rs180059626; RSID:rs41143666; RSID:rs180059627; RSID:rs180059628; RSID:rs180059629; RSID:rs180059630; RSID:rs180059631; RSID:rs180059632; RSID:rs180059633; RSID:rs180059634; RSID:rs180059635; RSID:rs180059636; RSID:rs40948953; RSID:rs40733376; RSID:rs180059637; RSID:rs180059638; RSID:rs41104560; RSID:rs41159133; RSID:rs40658639; RSID:rs41123662; RSID:rs41000375; RSID:rs41196101; RSID:rs180059639; RSID:rs180059640; RSID:rs41101957; RSID:rs40658638; RSID:rs40658640; RSID:rs40848122; RSID:rs40698511; RSID:rs180059641; RSID:rs41191939; RSID:rs41251189; RSID:rs40825335; RSID:rs180059642; RSID:rs180059643; RSID:rs180059644; RSID:rs180059646; RSID:rs180059647; RSID:rs180059648; RSID:rs180059649; RSID:rs180059650; RSID:rs180059651; RSID:rs180059652; RSID:rs180059653; RSID:rs180059654; RSID:rs180059656; RSID:rs180059657; RSID:rs180059658; RSID:rs180059659; RSID:rs180059660; RSID:rs180059661; RSID:rs180059662; RSID:rs179409870; RSID:rs179409869; RSID:rs180059663; RSID:rs179823578; RSID:rs180059669; RSID:rs180059668; RSID:rs180059667; RSID:rs180059666; RSID:rs180059665; RSID:rs180059664;
DisordersAndMutations The MO1-gli3 sequence is 5' - ACAACTGGGCATTCCTCAGAGCATC - 3'. The MO2-gli3 sequence is 5' - GACAGGATACTCGTTGTTGTGAAAC - 3'. ZFINID:ZDB-GENO-070914-4; ZFINID:ZDB-GENO-100528-16; ZFINID:ZDB-GENO-110513-5; ZFINID:ZDB-GENO-070927-3; ZFINID:ZDB-GENO-110513-6; ZFINID:ZDB-GENO-070927-4;
RelatedPubMedArticles Hadzhiev, Y.; Lele, Z.; Schindler, S.; Wilson, S.W.; Ahlberg, P.; Strähle, U.; Müller, F.:Hedgehog signaling patterns the outgrowth of unpaired skeletal appendages in zebrafish. BMC Dev Biol ; 7:75.2007. PMID:17597528 .Tyurina, O.V.; Guner, B.; Popova, E.; Feng, J.; Schier, A.F.; Kohtz, J.D.; Karlstrom, R.O.:Zebrafish Gli3 functions as both an activator and a repressor in Hedgehog signaling. Dev Biol. ;277(2):537-56.2005. PMID:15617692 .Vanderlaan, G.; Tyurina, O.V.; Karlstrom, R.O.; Chandrasekhar, A.:Gli function is essential for motor neuron induction in zebrafish. Dev Biol. ;282(2):550-70. 2005. PMID:15890329 . NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort