Tags:
create new tag
, view all tags

gfpt1

glutamine-fructose-6-phosphate transaminase 1

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName gfpt1
Aliases ENSDARG:ENSDARG00000057465; Eartha; eartha2
Description glutamine-fructose-6-phosphate transaminase 1
GenomicLocation chromosome 8 52760108-52797249 reverse strand
ExternalIDs Entrez:567861; UniGene:94310; ZFIN:ZDB-GENE-070423-1;
TranscriptID ENSDART:ENSDART00000080135;
mRNA NCBI:NM_001034981
GeneDescription gfpt1 (glutamine:fructose-6-phosphate aminotransferase 1) is the rate-limiting enzyme that catalyzes the formation of glucosamine-6-phosphate in the hexosamine biosynthesis pathway. The major end product of this pathway is UDP-N-acetylglucosamine (UDP-GlcNAc), which is one of the building blocks for glycosyl side chains for many glycoproteins and proteoglycans.
GeneFunction Yang CT et al., 2007 inferred from their studies of earthaj23e1 mutation of gfpt1 (glutamine:fructose-6-phosphate aminotransferase 1) that gfpt1 acts cell autonomously in melanocytes to promote ontogenetic melanocyte darkening. Their findings implied that gfpt1 acts cell autonomously in melanocytes to promote melanocyte differentiation from dopachrome tautomerase+ (dct+); melanin− to melanin+ stage during melanocyte regeneration.
GeneCloning

GeneStructure The gene encodes a single transcript (ENSDART00000080135) which consists of 12 exons and is 1,281 bps in length. The protein product (ENSDARP00000074585) consists of 426 residues
Protein ENSDARP00000074585
ProteinDomainandFamilies has domain InterPro:IPR005855; InterPro:IPR000583; InterPro:IPR017932; InterPro:IPR001347;
Motifs has motif Prosite:PS51464; Prosite:PS51278; PFAM:PF01380; PFAM:PF00310;
Expression ArrayExpress:ENSDARG00000057465;
GeneOntology GO:0004360; GO:0005529; GO:0016051; GO:0005975; GO:0002063; GO:0048703; GO:0030318; GO:0008152; GO:0005737;
Orthologs Entrez:2673;
VariationAndRepeats RSID:rs180089532; RSID:rs41167582; RSID:rs180089524; RSID:rs180089522; RSID:rs180089512; RSID:rs180089504; RSID:rs180089495; RSID:rs180089485; RSID:rs180089447; RSID:rs180089469; RSID:rs180089427; RSID:rs180089414
DisordersAndMutations The MO1-gfpt1 sequence is 5' - TCAGATACGCAAATATGCCACACAT - 3'. ( Senderek et al., 2011). The MO2-gfpt1 sequence is 5' - TGCTGGAATGTGTTACTTGCCAGAA - 3'. ZFINID:ZDB-GENO-070423-2; ZFINID:ZDB-GENO-070426-3; ZFINID:ZDB-GENO-071114-1; ZFINID:ZDB-GENO-100521-2;
RelatedPubMedArticles Yang, C.T.; Hindes, A.E.; Hultman, K.A.; Johnson, S.L.: Mutations in gfpt1 and skiv2l2 cause distinct stage-specific defects in larval melanocyte regeneration in zebrafish. PLoS Genet. ;3(6):e88.2007 Jun Epub 2007 Apr 17, PMID:17542649 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-12 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort