Tags:
create new tag
, view all tags

fzd2

frizzled homolog 2

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName fzd2
Aliases ENSDARG:ENSDARG00000054438; fz8; zfz2; zg08; cb383; wu:fb70g09
Description frizzled homolog 2
GenomicLocation chromosome 3 31758800-31761152 forward strand
ExternalIDs Entrez:30370; EMBL:U49412; UniGene:12607; ZFIN:ZDB-GENE-990415-224;
TranscriptID ENSDART:ENSDART00000076636
mRNA NCBI:NM_131140
GeneDescription Fzd2 belongs to the frizzled (Fz) family of seven-pass transmembrane proteins that act as receptors for the wnt family of secreted glycoprotein signalling molecules. They are said to be critical for numerous cell fate and tissue polarity decisions during development. The Fz-2 recptor binds to the ligand wnt5 and brings about proper insulin-cell migration in zebrafish.
GeneFunction Kim HJ et al. (2005) reported a novel role of Wnt/Fz-2 signaling in organogenesis using the formation of the islet during pancreatic development as a model tissue. They showed by time lapse imaging technique that the Wnt-5 ligand and the Fz-2 receptor are required for proper insulin-cell migration in zebrafish. Their results implicated a conserved role of a Wnt5/Fz2 signaling pathway in islet formation during pancreatic development suggested a crucial role of Wnt signaling in vertebrate organ development and disease.Oishi et al. (2006) reported that Frizzled-2-mediated noncanonical Wnt signalling is essential for the function of duboraya (dub) in ciliogenesis regulated by phosphorylation.
GeneCloning The gene is contained in DKEY-194J22 (Vector: pIndigoBAC-536).
GeneStructure This gene encodes a single transcript(ENSDART00000076636) which consits 1 of exons and is 2,442 bps in length.The protein product (ENSDARP00000071107) consists of 556 residues.
Protein ENSDARP00000071107
ProteinDomainandFamilies has domain ;InterPro:IPR015526; InterPro:IPR000539; InterPro:IPR000832;
Motifs has motif PFAM:PF01392; PFAM:PF01534; PRINTS:PR00489;
Expression ArrayExpress:ENSDARG00000054438;
GeneOntology GO:0016020; GO:0016021; GO:0007165; GO:0007275; GO:0031018; GO:0007368; GO:0042384; GO:0007166; GO:0016477; GO:0007223; GO:0016055; GO:0007186; GO:0004888; GO:0004871; GO:0004872;GO:0004930;
Orthologs Entrez:2535;
VariationAndRepeats [[RSID:rs41092544[[RSID:rs40897439[[RSID:rs40854090[[RSID:rs179727294[[RSID:rs179727266[[RSID:rs179727316RSID:rs179727238
DisordersAndMutations The following antisense morpholinos have been used fOr the knockdown of Fz-2 gene MO 1 having the sequence 5'-ACA AAA TGA GTC CGG CAA ACT ATG C (Fong et al., 2005) , MO 2 having the sequence 5' - CCTGCATTGTCTCGAAAAGTTCCGC - 3' and MO 3 having the sequence- 5' - CACACACACTTCCACTCGCCTGCAT - 3'.
RelatedPubMedArticles Oishi, I.; Kawakami, Y.; Raya, A.; Callol-Massot, C.; Izpis˙a Belmonte, J.C.: Regulation of primary cilia formation and left-right patterning in zebrafish by a noncanonical Wnt signaling mediator, duboraya. Nat Genet. ;38(11):1316-22., 2006 Epub 2006 Oct 1, PMID:17013396 .Kim, H.J.; Schleiffarth, J.R.; Jessurun, J.; Sumanas, S.; Petryk, A.; Lin, S.; Ekker, S.C.: Wnt5 signaling in vertebrate pancreas development. BMC Biol. ;3:23, 2005. PMID:16246260 .Fong, S.H.; Emelyanov, A.; Teh, C.; Korzh, V.: Wnt signalling mediated by Tbx2b regulates cell migration during formation of the neural plate. Development. ;132(16):3587-96. 2005. Epub 2005 Jul 20, PMID:16033799 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-30 - AravindR
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort