Tags:
create new tag
, view all tags

flh

floating head

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName flh
Aliases ENSDARG:ENSDARG00000021201; Znot; flh
Description floating head
GenomicLocation chromosome 13 14837121-14839117 forward strand
ExternalIDs Entrez:30260; EMBL:L48017; UniGene:352; ZFIN:ZDB-GENE-990415-75
TranscriptID ENSDART:ENSDART00000011520
mRNA NCBI:NM_131055
GeneDescription The gene encodes a homeodomain transcription factor called as Floating head (Flh). The Flh regulates expression of two basic helix loop helix (bHLH) transcription factor encoding genes, ash1a (achaete/scute homologue 1a) and neurogenin1 (ngn1), in epiphysial neural progenitors required for generation of neurones in the zebrafish epiphysis.
GeneFunction Halpern et al. (1995) studied the cell-autonomous shift from axial to paraxial mesodermal development in zebrafish floating head mutants wherein they suggested that wild-type floating head provides an essential step in maintaining, rather than initiating, development of notochord-forming axial mesoderm.Talbot WS et al. (1995) were the first to show that floating head is the zebrafish homologue of Znot, a homeobox gene expressed in the amphibian organizer and notochord. They proposed that flh regulates notochord precursor cell fate. Danos MC et al. (1996) showed that floating head (Znot) encodes putative transcription factors that are expressed in the organizer and notochord, structures which regulate dorsoventral and anterioposterior development in vertebrate embryos.Melby AE et al. (1997) investigated the role of flh in regulating notochord development in detail. They showed that flh positively regulates its own expression and flh+ function is specifically required to maintain flh expression in hypoblast cells. They also hypothesized that ntl+ is required for the proper convergence movements of flh-expressing cells.Fouquet B. (1997) suggested that signals from the notochord may guide angioblasts in the fashioning of the dorsal aorta which implies an indirect role of flh in regulation of this process.Massai I et al. (1997) show that the homeobox containing gene floating head (flh) is required for neurogenesis to proceed in the epiphysis. They demonstrated that the epiphysial phenotype of masterblind (mbl)- embryos is mediated by ectopic Flh activity. They proposed a role for flh in linking the signaling pathways that regulate regional patterning to the signaling pathways that regulate neurogenesis.Amacher et al. (1998) revealed that repression of spadetail function by floating head is critical to promote notochord fate and prevent midline muscle development, and that enviromental signals can override the predisposition of floating head mutant midline cells to make muscle cells.Tongiorgi E . (1999) showed that flh regulates notochord development which in turn is a key factor regulating the expression of extracellular matrix molecule tenascin-C during embryonic development. They postulated that flh has a role in somite patterning as they show defective tn-C expression in somite of flh mutants.Gothilf Yet al. (1999) showed that flh regulation is closely associated with zebrafish serotonin N-acetyltransferase-2 which is a marker for development of pineal photoreceptors and circadian clock function.Majumdar A et al. (2000) investigated the role of flh in glomerular differentiation in the absence of the notochord and vascularization from the dorsal aorta.Biemar et al. (2001) showed that flh , necessary for differentiation of chordamesoderm to notochord, is indirectly responsible for proper pancreas development, but not required for differentiation of pancreatic cell fates.Cau E et al. (2003) in order to elucidate the pathways regulating epiphysial neurogenesis showed that show that Flh is required to maintain the expression of ash1a and to initiate expression of ngn1 and neuroD (all three are bHLH transcription factors expressed in hypophysis). They stated that flh has additional activities other than regulating ash1a and of ngn1 as flh mtant epiphysis could account for most of the neuorgenesis defects. Their results confirmed that Flh functions as a prepattern gene, linking patterning to neurogenesis, and reveal a crucial role for two bHLH proteins, acting downstream of Flh, in the control of epiphysial neurogenesis.Snelson CD et al. (2008) studied flh mutants to identify their involvement in tbx2b transcription and found that flh regulates a separate program for pineal and parapineal development and is not required for tbx2b transcription
GeneCloning

GeneStructure The gene encodes for a single transcript (ENSDART00000011520) having 3 exons and is 959 bps in length. The protein product (ENSDARP00000022555) consists of 243 residues
Protein ENSDARP00000022555
ProteinDomainandFamilies has domain InterPro:IPR001356;
Motifs has motif Prosite:PS00027; PFAM:PF00046; PRINTS:PR00024; PRINTS:PR00028;
Expression ArrayExpress:ENSDARG00000021201
GeneOntology GO:0005634; GO:0006355; GO:0045449; GO:0030325; GO:0035051; GO:0007368; GO:0006353; GO:0031564; GO:0006350; GO:0003700; GO:0043565; GO:0003677;
Orthologs Entrez:344022
VariationAndRepeats RSID:rs41096337
DisordersAndMutations MO1-flh- 5' - GGGAATCTGCATGGCGTCTGTTTAG - 3'; MO2-flh- 5' - GTAAGCTCTTCCGGGAATCTGCATG - 3'; MO3-flh- 5' - AATCTGCATGGCGTCTGTTTAGTCC - 3'
RelatedPubMedArticles Halpern, ME; Thisse, C; Ho, RK; Thisse, B Riggleman, B; Trevarrow, B; Weinberg, ES; Postlethwait, JH; Kimmel, CB. Cell-autonomous shift from axial to paraxial mesodermal development in zebrafish floating head mutants. Development. 121(12):4257-64, 1995. PMID:8575325 .Talbot, WS; Trevarrow, B; Halpern, ME; Melby, AE; Farr, G; Postlethwait, JH; Jowett, T; Kimmel, CB; Kimelman, D. A homeobox gene essential for zebrafish notochord development. Nature. 9;378(6553):150-7, 1995. PMID:7477317 .Melby, AE; Warga, RM; Kimmel, CB. Specification of cell fates at the dorsal margin of the zebrafish gastrula. Development. 122(7):2225-37, 1996. PMID:8681803 .Danos, MC; Yost, HJ. Role of notochord in specification of cardiac left-right orientation in zebrafish and Xenopus. Dev Biol. 10;177(1):96-103, 1996. PMID:8660880 .Halpern, ME; Hatta, K; Amacher, SL; Talbot, WS; Yan, YL; Thisse, B; Thisse, C; Postlethwait, JH; Kimmel, CB. Genetic interactions in zebrafish midline development. Dev Biol. 15;187(2):154-70, 1997. PMID:9242414 .Melby, AE; Kimelman, D; Kimmel, CB. :Spatial regulation of floating head expression in the developing notochord. Dev Dyn. 209(2):156-65. 1997. PMID:9186051 .Fouquet, B; Weinstein, BM; Serluca, FC; Fishman, MC. Vessel patterning in the embryo of the zebrafish: guidance by notochord. Dev Biol. 183(1):37-48, 1997. PMID:9119113 . Masai, I; Heisenberg, CP; Barth, KA; Macdonald, R; Adamek, S; Wilson, SW. Floating head and masterblind regulate neuronal patterning in the roof of the forebrain. Neuron. 18(1):43-57.1997. PMID:9010204 . Amacher, SL; Kimmel, CB. Promoting notochord fate and repressing muscle development in zebrafish axial mesoderm. Development. 125(8):1397-406, 1998. PMID:9502721 .Gothilf, Y; Coon, SL; Toyama, R; Chitnis, A; Namboodiri, MA; Klein, DC. Zebrafish serotonin N-acetyltransferase-2: marker for development of pineal photoreceptors and circadian clock function. Endocrinology. 140(10):4895-903, 1999. PMID:10499549 .Tongiorgi, E.: Tenascin-C expression in the trunk of wild-type, cyclops and floating head zebrafish embryos. Brain Res Bull. 1;48(1):79-88, 1999. PMID:10210171 .Biemar, F; Argenton, F; Schmidtke, R; Epperlein, S; Peers, B; Driever, W. Pancreas development in zebrafish: early dispersed appearance of endocrine hormone expressing cells and their convergence to form the definitive islet. Dev Biol. 15;230(2):189-203, 2001. PMID:11161572 .Gothilf, Y; Toyama, R; Coon, SL; Du, SJ; Dawid, IB; Klein, DC. :Pineal-specific expression of green fluorescent protein under the control of the serotonin-N-acetyltransferase gene regulatory regions in transgenic zebrafish. Dev Dyn. 225(3):241-9, 2002. PMID:12412006 .Au, E; Wilson, SW. Ash1a and Neurogenin1 function downstream of Floating head to regulate epiphysial neurogenesis.Development. 130(11):2455-66, 2003. PMID:12702659 . Yin, C and Solnica-Krezel, L.: Convergence and extension movements affect dynamic notochord-somite interactions essential for zebrafish slow muscle morphogenesis. Dev. Dyn. 236(10): 2742-2756, 2007. PMID:17849437 .Snelson, CD; Burkart; JT; Gamse, JT.: Formation of the asymmetric pineal complex in zebrafish requires two independently acting transcription factors. Dev Dyn. 237(12):3538-44, 2008. PMID:18629869 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-22 - AravindR
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort