Tags:
create new tag
, view all tags

fgf8a

fibroblast growth factor 8 a

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName fgf8a
Aliases ENSDARG:ENSDARG00000003399; ace; fgf8; cb110; fgf-8; MGC101652; id:ibd5031; wu:fb73a06; etID309886.13; fgf8a
Description fibroblast growth factor 8 a
GenomicLocation Chromosome 13: 20,566,784-20,573,252 reverse strand.
ExternalIDs Entrez:30538; ZFIN:ZDB-GENE-990415-72; UniGene:478
TranscriptID ENSDART:ENSDART00000025583; ENSDART:ENSDART00000144968
mRNA NCBI:NM_131281
GeneDescription The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair etc.
GeneFunction Draper et al. (2003) reported that fgf8 is one of the principle gene required for proper mesodermal development but also that it is not the only ligand required. Through experimental analysis they found that fgf8 together with fgf24 is required for the posterior mesodermal development.They saw that fgf8 is expressed in the germring and also in the presumptive brain in a domain that spans from future midhindbrain junction posteriorly to rhombomere 4.
GeneCloning The gene is contained in a BAC clone CH211-194I8 (Vector: pTARBAC2.1).
GeneStructure This gene encodes a single transcript(ENSDART00000025583) which has 5 exons and is 2,140 bps in length.The protein product (ENSDARP00000018653) consists of 210 residues.
Protein ENSDARP00000018653 ENSDARP00000119341
ProteinDomainandFamilies has domain InterPro:IPR002348; InterPro:IPR008996;
Motifs has motif Prosite:PS00247; PFAM:PF00167
Expression ArrayExpress:ENSDARG00000003399;
GeneOntology GO:0048263,GO:0009953,GO:0007492,GO:0042664,GO:0030916,GO:0046850,GO:0009952, GO:0001708, GO:0007368,GO:0009953,GO:0035050,GO:0009880,GO:0060059,GO:0030902,GO:0021703,GO:0007498,GO:0030901,GO:0048665,GO:0030903,GO:0048709,GO:0043049,GO:0048339,GO:0007422,GO:0060037,GO:0030177, GO:0030335,GO:0060041,GO:0021571,GO:0021572,GO:0001756,GO:0070121,GO:0055011,GO:0007420,GO:0003208,GO:0010002,GO:0051216,GO:0021588,GO:0060271,GO:0060788,GO:0031076,GO:0003007,GO:0048839, GO:0030917,GO:0030182, GO:0009887,GO:0048705,GO:0051146,GO:0061195,GO:0030878,GO:0055012,GO:0005615, GO:0005764
Orthologs Entrez:2253;
VariationAndRepeats RSID:rs180115800; RSID:rs180115799; RSID:rs41190760; RSID:rs180115798; RSID:rs41012871; RSID:rs41227468; RSID:rs40874994; RSID:rs180115797
DisordersAndMutations MO1-fgf8a- 5' - TAGGATGCTCTTACCATGAACGTCG - 3' ;MO2-fgf8a -5' - CACATACCTTGCCAATCAGTTTCCC - 3' ;MO3-fgf8a - 5' - GAGTCTCATGTTTATAGCCTCAGTA - 3'; MO4-fgf8a - 5' - TGAGTCTCATGTTTATAGCCTCAGT - 3';MO5-fgf8a - 5' - TCAACCGTGAAGGTATGAGTCTC - 3';
RelatedPubMedArticles Draper, B.W.; Stock, D.W.; Kimmel, C.B.:Zebrafish fgf24 functions with fgf8 to promote posterior mesodermal development.- Development. ; 130(19):4639-54.2003. PMID:12925590 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2013-08-23 - AravindR
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort