Tags:
create new tag
, view all tags

fgf24

fibroblast growth factor 24

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName fgf24
Aliases ENSDARG:ENSDARG00000037677; lbx1h; SI:zC207O21.2; si:zc207o21.1; SI:zC207O21.1 (fibroblast growth factor 24); fgf24.
Description fibroblast growth factor 24
GenomicLocation chromosome 14 5513975-5552666 reverse strand
ExternalIDs Entrez:359831; EMBL:AY204859; UniGene:82992; ZFIN:ZDB-GENE-030708-1;
TranscriptID ENSDART:ENSDART00000054877
mRNA NCBI:NM_182871
GeneDescription The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair etc
GeneFunction Draper et al. (2003) reported that fgf24 in conjugation with fgf8 are responsible for proper mesodermal development. They experimentally found that inhibiting fgf24 function alone, in Zebrafish, does not effect the development of posterior mesoderm , but inhibition of fgf24 function in fgf8 mutants completely inhibits posterior mesoderm development. They determined the fgf24 expression patterns in the gastrula stage and found that the fgf24 transcripts were expressed in the dorsalmost cells in the blastula margin during epiboly and continued in the marginal cells upto gatrulation and were localized in the tail bud by the end of gastrulation.Manfroid et al. (2007) found that fgf24 is involved in ventral pancreatic bud specifications. They tested various fgf genes and found that fgf24 is expressed in pancreatic region. Using the knockdown methods they found that inactivation of fgf24 function resulted in significant reduction in pancreatic exocrine compartment, but in some of the fgf24 mutants it was found that though reduced but still the differentiation of trypsin expressing cells occurred thus showing that fgf24 does not inhibit pancreatic specification but brings about a delay in ventral pancreatic bud specifications.
GeneCloning The gene contained CH211-207O21 (Vector: pTARBAC2.1).
GeneStructure This gene encodes 3 transcripts out of which 2 are novel; (ENSDART00000054877) which consists of 5 exons and is 1,377bps in length.The protein product (ENSDARP00000054876) consists of 208 residues (ENSDART00000106686) which consists of 4 exons and is 636 bps in length. The protein product (ENSDARP00000097464) consists of 211 residues.(NOVEL) (ENSDART00000106685) which consists of 4 exons and is 636 bps in length. The protein product (ENSDARP00000097463) consists of 212 residues.(NOVEL)
Protein ENSDARP00000054876
ProteinDomainandFamilies has domain InterPro:IPR008996;
Motifs has motif Prosite:PS00247; PFAM:PF00167; PRINTS:PR00262;
Expression ArrayExpress:ENSDARG00000037677
GeneOntology GO:0042664; GO:0035050; GO:0009953; GO:0035118; GO:0008083; GO:0031017;
Orthologs

VariationAndRepeats [[RSID:rs180164700[[RSID:rs180164699[[RSID:rs40938939[[RSID:rs41114120[[RSID:rs180164698[[RSID:rs41004040[[RSID:rs180164697[[RSID:rs180164696[[RSID:rs180164695[[RSID:rs180164694RSID:rs41212231
DisordersAndMutations MO1-fgf24- 5' - AGGAGACTCCCGTACCGTACTTGCC - 3';MO2-fgf24- 5' - GACGGCAGAACAGACATCTTGGTCA - 3'
RelatedPubMedArticles Draper, B.W.; Stock, D.W.; Kimmel, C.:Zebrafish fgf24 functions with fgf8 to promote posterior mesodermal development.- Development.; 130(19):4639-54. 2003. PMID:12925590 Manfroid, I.; Delporte F.; Baudhuin, A.; Motte, P.; Neumann, C.J.; Voz, M.L.; Martial, J.A.; Peers, B.:Reciprocal endoderm-mesoderm interactions mediated by fgf24 and fgf10 govern pancreas development. Development. ;134(22):401121.2007. PMID:17942484
NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-23 - AravindR
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort