Tags:
create new tag
, view all tags

Fgf20b

fibroblast growth factor 20b

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName Fgf20b
Aliases ENSDARG:ENSDARG00000071556;
Description fibroblast growth factor 20b
GenomicLocation Chromosome 1: 15,741,605-15,743,001 reverse strand.
ExternalIDs ZFIN:ZDB-GENE-060117-5;
TranscriptID ENSDART:ENSDART00000131174
mRNA NCBI:NM_001039172
GeneDescription Fgf20b is a member of the Fgf (fibroblast growth factor) family of proteins. It is paralogous to fgf20a in zebrafish and orthologous to human FGF20.
GeneFunction Itoh et al. (2007) identified fgf20b which duplicates and translocates giving arise to fgf20a and so indirectly involved in blastema formation.
GeneCloning fgf20b is contained in the BAC clone named CH73-56I11 (Library: CHORI-73 ; Vector: pTARBAC2 ; Source: BACPAC Resources Center )
GeneStructure It encodes single transcripts (ENSDART00000105871) which consist of 3 exons and is 627 bps in length. The protein product (ENSDARP00000096649) consists of 208 residues.
Protein ENSDARP00000106996
ProteinDomainandFamilies has domain InterPro:IPR002209;
Motifs has motif Prosite:PS00247; PFAM:PF00167; PRINTS:PR00262; PRINTS:PR00263;
Expression ArrayExpress:ENSDARG00000071556;
GeneOntology GO:0008083;
Orthologs Entrez:26281;
VariationAndRepeats RSID:rs179619078; RSID:rs179619331; RSID:rs179619224; RSID:rs179618908; RSID:rs179619422; RSID:rs179619530; RSID:rs179618957; RSID:rs179619564; RSID:rs179619150; RSID:rs179619739; RSID:rs40947454; RSID:rs41101191; RSID:rs40842353
DisordersAndMutations MO1-fgf20b- 5' - AAGACAAGTCTGCTTACTGACCAT - 3';MO2-fgf20b- 5' - TTCCAAAATACCTGGAGAAGAATAA - 3'
RelatedPubMedArticles Itoh N, Konishi M.: The zebrafish fgf family. PMID:18041922 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-23 - AravindR
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort