Tags:
create new tag
, view all tags

fech

ferrochelatase

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName fech
Aliases ENSDARG:ENSDARG00000003462; zgc:109851, dracula, drc, fch, ferrochelatase
Description ferrochelatase
GenomicLocation chromosome 21 1970738-1996552 forward strand
ExternalIDs Entrez:58215; UniGene:82519; ZFIN:ZDB-GENE-000928-1;
TranscriptID ENSDART:ENSDART00000148540; ENSDART:ENSDART00000113389
mRNA NCBI:NM_131631
GeneDescription The protein encoded by this gene is localized to the mitochondrion, where it plays a role in the integration of the ferrous form of iron into protoporphyrin IX in the heme synthesis pathway.
GeneFunction Mutations in this gene are associated with erythropoietic protoporphyria
GeneCloning The gene is contained in FOSMID clone CH1073-334H6 (Vector: pCC1FOS-CHA_PmII).
GeneStructure This gene encodes two transcripts. Transcript ENSDART00000113389 consists of 12 exons and is 4786 bps in length. The protein product ENSDARP00000099760 consists of 409 residues. Transcript ENSDART00000148540 consists of 11 exons and is 1431 bps in length. The protein product ENSDARP00000125028 consists of 409 residues.
Protein ENSDARP00000125028 ENSDARP00000099760
ProteinDomainandFamilies has domain InterPro:IPR019772; InterPro:IPR001015;
Motifs has motif Prosite:PS00534; PFAM:PF00762;
Expression ArrayExpress:ENSDARG00000003462
GeneOntology GO:0016829; GO:0006779; GO:0043249; GO:0006783; GO:0004325;
Orthologs Entrez:2235;
VariationAndRepeats RSID:rs40760543; RSID:rs180071963; RSID:rs180071964; RSID:rs40820031; RSID:rs40848355; RSID:rs40824226; RSID:rs180071966; RSID:rs40651127; RSID:rs180071968; RSID:rs180055777;
DisordersAndMutations The morpholino for the gene fgf10a are: MO1-fech 5' - CCCATATTCAGCATCAGAATGCCTG - 3' (Nilsson et al., 2009) MO2-fech 5' - CGGGAAGTGTCCTCGTGTTCCAGCT - 3'. ZFINID:ZDB-GENO-091118-1; ZFINID:ZDB-GENO-980202-143; ZFINID:ZDB-GENO-980202-222; ZFINID:ZDB-GENO-980202-296; ZFINID:ZDB-GENO-980202-359; ZFINID:ZDB-GENO-080606-296; ZFINID:ZDB-GENO-980202-903; ZFINID:ZDB-GENO-120312-30; ZFINID:ZDB-GENO-120312-32; ZFINID:ZDB-GENO-130109-5;
RelatedPubMedArticles Weinstein BM, Schier AF, Abdelilah S, Malicki J, Solnica-Krezel L, Stemple DL, Stainier DY, Zwartkruis F, Driever W, Fishman MC. Hematopoietic mutations in the zebafish. Development. 1996 Dec;123:303-9. PMID:9007250 Childs S, Weinstein BM, Mohideen MA, Donohue S, Bonkovsky H, Fishman MC. Zebrafish dracula encodes ferrochelatase and its mutation provides a model for erythropoietic protoporphyria. Curr Biol. 2000 Aug 24;10(16):1001-4. PMID:10985389 North TE, Zon LI. Modeling human hematopoietic and cardiovascular diseases in zebrafish. Dev Dyn. 2003 Nov;228(3):568-83. PMID:14579393 Davidson AJ, Zon LI. The 'definitive' (and 'primitive') guide to zebrafish hematopoiesis. Oncogene. 2004 Sep 20;23(43):7233-46. Review. PMID:15378083 Wingert RA, Galloway JL, Barut B, Foott H, Fraenkel P, Axe JL, Weber GJ, Dooley K, Davidson AJ, Schmid B, Paw BH, Shaw GC, Kingsley P, Palis J, Schubert H, Chen O, Kaplan J, Zon LI; Tübingen 2000 Screen Consortium. Deficiency of glutaredoxin 5 reveals Fe-S clusters are required for vertebrate haem synthesis. Nature. 2005 Aug 18;436(7053):1035-39. Erratum in: Nature. 2005 Oct 6;437(7060):920. Schmidt, Bettina [corrected to Schmid, Bettina]. PMID:16110529 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2013-08-31 - AnkitSabharwal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort