Tags:
create new tag
, view all tags

erbb2

v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName erbb2
Aliases ENSDARG:ENSDARG00000026294; wu:fv70f10, zgc:63601, erbb2
Description v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog
GenomicLocation chromosome 12 10108666-10192429 reverse strand
ExternalIDs Entrez:386966; EMBL:BC055160; UniGene:52559; ZFIN:ZDB-GENE-031118-121;
TranscriptID ENSDART:ENSDART00000114258; ENSDART:ENSDART00000135041; ENSDART:ENSDART00000003932
mRNA NCBI:NM_200119
GeneDescription Erbb2 is a receptor tyrosine kinase proto-oncogene and is a member of the epidermal growth factor (EGF) receptor family. The receptors form dimers with individual monomers exhibiting different activities and ligand specificities: that ErbB signals are required in embryos for adult pigment pattern formation
GeneFunction Lai et al.(2005) showed erbb3b as a heterodimer and a component of primary receptor for neuregulin-1 in Schwann cells. He also revealed that erbb3b signaling provides one of the cues for Schwann cell migration .Lyons et al. (2005) injected antisense morpholino oligonucleotides which showed that erbb2 is essential for early stages of glial development . He studied MO phenocopy and concluded that erbb2 is is disrupted by the st61 and st50 mutations. Sequence analysis of the erbb2 gene in identified a premature stop codon in st61 mutants. He also showed that zebrafish ErbB3 protein is 54% identical to the human ErbB3 protein and has characteristic ErbB3 sequence features, including a kinase homology domain.Budi et al. (2008) examined molecular markers for metamorphic melanophore development in embryos and showed that it was expressed in metamorphic melanophores and fins. He showed that ErbB2 lacks its own high affinity ligand .Honjo et al. (2008) examined erbb2 mutants. These mutants do not form DRG or sympathetic neurons, whereas enteric neurons appeared normal. Therefore he revealed that erbb2 signaling is required for sympathetic neuron formation but not for enteric neurons.
GeneCloning erbb2 is contained in the BAC clone named DKEY-25P11
GeneStructure "This gene encodes 3 transcripts The transcripts (ENSDART00000114258) consists of 28 exons and is 7,050 bps in length. The protein product (ENSDARP00000099586) consists of 1,275 residues. The transcripts (ENSDART00000003932) consists of 27 exons and is 4093 bps in length. The protein product (ENSDARP00000010252) consists of 1,275 residues. (ENSDART00000135041) consists of 2 exons and is 765 bps in length. It does not code for protein product. "
Protein ENSDARP00000099586 ENSDARP00000010252
ProteinDomainandFamilies has domain InterPro:IPR000719; InterPro:IPR006212; InterPro:IPR017441; InterPro:IPR000494; InterPro:IPR016245; InterPro:IPR006211; InterPro:IPR001245; InterPro:IPR008266;
Motifs has motif Prosite:PS00107; Prosite:PS00109; PFAM:PF00069; PFAM:PF00757; PFAM:PF01030; PFAM:PF07714; PRINTS:PR00109;
Expression ArrayExpress:ENSDARG00000026294;
GeneOntology GO:0005524, GO:0016301, GO:0000166, GO:0004672, GO:0004713, GO:0004716, GO:0016740, GO:0016772, GO:0004714, GO:0016310.GO:0006468, GO:0023014, GO:0007169, GO:0014044, GO:0007413, GO:0060973, GO:0001837, GO:0031101, GO:0060347,GO:0042552, GO:0048914, GO:0001755, GO:0032285, GO:0048919, GO:0016021,GO:0016020
Orthologs Entrez:Gene:2064
VariationAndRepeats

DisordersAndMutations Morpholino MO1-erbb2 (5' - GTCCGCCTCCATCGATTATTCCTCC - 3') has been directed against erbb2. They were identified with pigment pattern defects.
RelatedPubMedArticles Lai, C.: Peripheral glia: Schwann cells in motion.Curr Biol. ;15(9):R332-4, 2005. PMID:15886089 Lyons, D.A.; Pogoda, H.M.; Voas, M.G.; Woods, I.G.; Diamond, B.; Nix, R.; Arana, N.; Jacobs, J.; Talbot, W.S.: erbb3 and erbb2 Are Essential for Schwann Cell Migration and Myelination in Zebrafish.Curr Biol. ;15(6):513-24, 2005. PMID: 15797019 Budi, E.H.; Patterson, L.B.; Parichy, D.M.: Embryonic requirements for ErbB signaling in neural crest development and adult pigment pattern formation. Development. ;135(15):2603-14.2008. PMID:18508863 Honjo, Y.; Kniss, J.; Eisen, J.S.: Neuregulin-mediated ErbB3 signaling is required for formation of zebrafish dorsal root ganglion neurons.Development. ;135(15):2615-25,2008. PMID:18599505 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-22 - ElvinLeonard
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort