Tags:
create new tag
, view all tags

epo

erythropoietin

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName epo
Aliases ENSDARG:ENSDARG00000055163; epo
Description erythropoietin
GenomicLocation chromosome 7 23058950-23086870 reverse strand
ExternalIDs Entrez:100004455; EMBL:DQ278896; UniGene:11767; ZFIN:ZDB-GENE-061218-3;
TranscriptID ENSDART:ENSDART00000020288; ENSDART:ENSDART00000111066; ENSDART:ENSDART00000077483
mRNA NCBI:NM_001038009
GeneDescription Erythropoietin (Epo) is a glycoprotein hormone which functions as a principal regulator of erythropoiesis. The main function of Epo is to inhibit the apoptosis of erythroid precursor cells and to increase their survival
GeneFunction Chu et al. (2007) isolated a gene encoding zebrafish epo. this had 55% and 32% similarity to fugu and human epo repectively.Investigation of the expression pattern of zepo was done by preparing cDNA from different developmental stages of zebrafish embryo and adult and was subjected to RT-PCR. It was found that in adult zebrafish the epo mRNA were predominantly expressed in liver and heart, while a low expression was also observed in brain ,glia, eye , intestine and kidney. In the embryo the zepo mRNA were expressed in forebrain, hindbrain, midbrain and brachial arch.Chu et al also prepared zepo Morpholinos to study the MO-mediated knockdown of zepo. It was found that zepo-MO injected embryos showed a significant loss in hemoglobin at 48 hpf.Paffett-Lugassy et al. (2007) also isolated cDNA from from a progressive developmental series of zebrafish embryos and from adult tissues, and studied the expression by quantitative RT-PCR.It was found that maternal transcripts for zebrafish epo were detected at low levels from prezygotic transcription to 24 hpf .The expression increases 36 hpf, coinciding with AGM hematopoiesis, after which expression levels are constant until 8 to 14 dpf. In adults, epo transcripts were detectable at high levels in the heart, and at lower levels in the brain, liver, and kidney.
GeneCloning epo Contained in: [BAC] DKEY-85K7
GeneStructure codes for 3 transcript (ENSDART00000020288) which has 5 exons and is :1825 bps in length.The protein product (ENSDARP00000021155 ) consists of 183 residues (ENSDART00000077483 ) which has 6 exons and is 1,223 bps in length.The protein product (ENSDARP00000071950 ) consists of 171 residues (ENSDART00000111066) which has 5 exons and is 1,312 bps in length. The protein product (ENSDARP00000100433) consists of 183 ersidues
Protein ENSDARP00000021155 ENSDARP00000100433 ENSDARP00000071950
ProteinDomainandFamilies has domain InterPro:IPR001323; InterPro:IPR012351; InterPro:IPR003013;
Motifs has motif PFAM:PF00758; PRINTS:PR00272; PRINTS:PR01485;
Expression ArrayExpress:ENSDARG00000055163;
GeneOntology GO:0005128, GO:0005179, GO:0030097, GO:0014823, GO:0043249, GO:0048471, GO:0005576
Orthologs Entrez:Gene:2056
VariationAndRepeats

DisordersAndMutations MO1-epo (5' - TGAAACATTCGCAAAACAACTTGGC - 3')
RelatedPubMedArticles Chu, C.Y.; Cheng, C.H.; Chen, G.D.; Chen, Y.C.; Hung, C.C.; Huang, K.Y.; Huang, C.J. :The zebrafish erythropoietin: functional identification and biochemical characterization.. FEBS Lett.;581(22):4265-71, 2007. PMID:17706649 Paffett-Lugassy ,N.; Hsia, N.; Fraenkel, P.G.; Paw, B.; Leshinsky, I.; Barut, B.; Bahary, N.; Caro, J.; Handin, R.; Zon, L.I.: Functional conservation of erythropoietin signaling in zebrafish..Blood.;110(7):2718-26, 2007. PMID:17579187 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-22 - ElvinLeonard
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort