Tags:
create new tag
, view all tags

dnmt1

DNA (cytosine-5-)-methyltransferase 1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName dnmt1
Aliases ENSDARG:ENSDARG00000030756; mta; cb983; dmnt1; cb1075; fb05h01; wu:fb05h01
Description DNA (cytosine-5-)-methyltransferase 1
GenomicLocation chromosome 3 55442890-55458859 reverse strand
ExternalIDs Entrez:30430; EMBL:BC044335; UniGene:25162; ZFIN:ZDB-GENE-990714-15;
TranscriptID ENSDART:ENSDART00000021977; ENSDART:ENSDART00000078973; ENSDART:ENSDART00000128041
mRNA NCBI:NM_131189
GeneDescription In the vertebrate genome, the transfer of a methyl group to the 5' position on cytosine residues located in the dinucleotide CpG is catalyzed by the DNA (cytosine-5)- methyltransferase enzyme (DNA MTase). Mammals encode at least three functional DNA MTases, Dnmt1, Dnmt3a, and Dnmt3b as well as a putative MTase, Dnmt2. Only Dnmt1 is present in abundance in somatic tissues of vertebrates.
GeneFunction Rai et al. (2006) reported that knockdown of Dnmt1 in zebrafish embryos caused defects in terminal differentiation of the intestine, exocrine pancreas, and retina. However, not all tissues require Dnmt1. Proper differentiation is depended on Dnmt1 catalytic activity, as Dnmt1 morphants could be rescued by active zebrafish or human DNMT1 but not by catalytically inactive derivatives. Dnmt1 morphants exhibited dramatic reductions of both genomic cytosine methylation and genome-wide H3K9 trimethyl levels, leading them to investigate the overlap of in vivo functions of Dnmt1 and Suv39h1. They reported that both Dnmt1, the primary maintenance DNA methyltransferase, and Suv39h1, the major H3K9 methyltransferase, direct terminal differentiation within specific organs of zebrafish. They found that zebrafish embryos deficient in either Dnmt1 or Suv39h1 specified the formation of retina, exocrine pancreas, and intestine but failed to complete terminal differentiation within these tissues. In contrast, terminal differentiation of other organs, including endocrine pancreas and liver, appeared unaffected. Phenotypic similarities of Dnmt1 and Suv39h1 knockdown in zebrafish embryos support their cooperative roles in gene regulation during development. They thus proposed that specific DNA and histone methyltransferases work in concert to control the spatial and temporal regulation of transcriptional programs that direct differentiation within specific organs.
GeneCloning

GeneStructure This encodes for 3 transcripts.


The transcript ENSDART00000021977 consists of 34 exons and is 4,896 bps in length. The protein product (ENSDARP00000013243) consists of 1,500 residues.

The transcript ENSDART00000043252 consists of 17 exons and is 2,379 bps in length. The protein product (ENSDARP00000043251) consists of 697 residues.

The transcript ENSDART00000078973 consists of 36 exons and is 4,779 bps in length. The protein product (ENSDARP00000073430) consists of 1,497 residues.


Protein ENSDARP00000013243 ENSDARP00000073430 ENSDARP00000108456
ProteinDomainandFamilies has domain InterPro:IPR001025; InterPro:IPR010506; InterPro:IPR002857; InterPro:IPR001525; InterPro:IPR017198;
Motifs has motif Prosite:PS00094; Prosite:PS00095; PFAM:PF00145; PFAM:PF01426; PFAM:PF02008; PFAM:PF06464; PRINTS:PR00105;
Expression ArrayExpress:ENSDARG00000030756;
GeneOntology GO:0005634; GO:0006306; GO:0051567; GO:0031017; GO:0060042; GO:0032776; GO:0003677; GO:0008134; GO:0008270; GO:0016740; GO:0008168;
Orthologs

VariationAndRepeats

DisordersAndMutations MO1-dnmt1: 5' - GAGACAATGAGGTCTTGGTAGGCAT - 3'

MO2-dnmt1: 5' - TCAAAGGAATTGACTACTTAAAAAC - 3'

MO3-dnmt1: 5' - TTAAAACAACAACAGATAAAAGCGG - 3'

MO4-dnmt1: 5' - ACAATGAGGTCTTGGTAGGCATTTC - 3'

RelatedPubMedArticles Rai, K., Chidester, S., Zavala, C.V., Manos, E.J., James, S.R., Karpf, A.R., Jones, D.A., and Cairns, B.R. (2007) Dnmt2 functions in the cytoplasm to promote liver, brain, and retina development in zebrafish. Genes Dev. 21(3):261-266. PMID:17289917
NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r4 - 2009-11-17 - MeghnaSingh
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort