Tags:
create new tag
, view all tags

Dcc

deleted in colorectal carcinoma

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName Dcc
Aliases ENSDARG:ENSDARG00000090360; zdcc
Description deleted in colorectal carcinoma
GenomicLocation Chr 5: 41024::98978 reverse starnd
ExternalIDs Entrez:569360; UniGene:121163; ZFIN:ZDB-GENE-011101-2
TranscriptID ENSDART:ENSDART00000126752
mRNA NCBI:NM_001034985
GeneDescription deleted in colorectal carcinoma
GeneFunction dcc is expressed highly in brain and spinal cord, but distinct staining was also observed in developing pectoral fins, pancreas, intestine, and heart. (Fricke and Chien, 2005).Knocking down dcc function by injecting antisense morpholino oligonucleotides prevented the contralateral dendrites of the octavolateralis efferent (Ole) neurons from crossing the midline. This study showed the role of dcc/netrin1 signaling in dendrite guidance or formation. (Suli et al., 2006: PMID: 17182783)
GeneCloning

GeneStructure This gene encodes a single transcript: (ENSDART00000126752) that contains 32 exons with the transcript length of 2,685 bps and has a protein product (ENSDARP00000109068) which consits 895 residues.
Protein ENSDARP00000109068
ProteinDomainandFamilies has domain InterPro:IPR003598; InterPro:IPR003962; InterPro:IPR013783; InterPro:IPR009138; InterPro:IPR003599; InterPro:IPR007110; InterPro:IPR010560; InterPro:IPR003961; InterPro:IPR008957; InterPro:IPR013098;
Motifs has motif Prosite:PS50835; Prosite:PS50853; PFAM:PF00041; PFAM:PF06583; PFAM:PF07679
Expression

GeneOntology GO:0038006; GO:0007155; GO:0033564; GO:0038007; GO:0071678; GO:0050918; GO:0016358; GO:0016358; GO:0048665; GO:0016021; GO:0016020;
Orthologs Entrez:1630
VariationAndRepeats RSID:rs180128617; RSID:rs180095377; RSID:rs180172606; RSID:rs180161436; RSID:rs180125010; RSID:rs180125000; RSID:rs180124996; RSID:rs180124986; RSID:rs180124979; RSID:rs180124972
DisordersAndMutations ZFINID:ZDB-GENO-130612-4; MO1-dcc:5' - GAATATCTCCAGTGACGCAGCCCAT - 3' ; MO2-dcc: 5' - GCGAAATCCGCTGCTAATCAATCAA - 3; MO3-dcc:5' - GAGCAGCACTGACCGTGTGTGTAGA - 3'
RelatedPubMedArticles Fricke C, Chien CB.Cloning of full-length zebrafish dcc and expression analysis during embryonic and early larval development.Dev Dyn. 2005 Nov;234(3):732-9. PMID: 16028271 .Suli A, Mortimer N, Shepherd I, Chien CB. Netrin/DCC signaling controls contralateral dendrites of octavolateralis efferent neurons. J Neurosci. 2006 Dec 20;26(51):13328-37. PMID: 17182783 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-26 - MeghnaSingh
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort