Tags:
create new tag
, view all tags

cyp26a1

cytochrome P450, subfamily XXVIA, polypeptide 1

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName cyp26a1
Aliases ENSDARG:ENSDARG00000033999; Cytochrome P450 26A1 (EC 1.14.-.-) (Retinoic acid-metabolizing cytochrome) (P450RAI) (Retinoic acid 4-hydroxylase).
Description cytochrome P450, subfamily XXVIA, polypeptide 1
GenomicLocation chromosome 12 9708963-9712555 reverse strand
ExternalIDs Entrez:30381; EMBL:BC055232; UniGene:75754; ZFIN:ZDB-GENE-990415-44;
TranscriptID ENSDART:ENSDART00000041728; ENSDART:ENSDART00000141212
mRNA NCBI:NM_131146
GeneDescription Cyp26a1 was the first identified cyp26 member (cytochrome P450, subfamily XXVI) and was first isolated from zebrafish. Cyp26a1 is expressed in the forebrain and midbrain during gastrulation.
GeneFunction Fujii et al. (1997) showed the role of cyp26a1in embryogenesis. Cyp26a1 is also found to exhibit a complex spatiotemporal expression pattern during early development.Dobbs-McAuliffe et al. (2004) observed the expression of cyp26a1 in three phases: in presumptive anterior neuroectoderm and in a circumblastoporal ring during gastrulation, in the tailbud throughout somitogenesis, and in multiple specific tissue types beginning at mid-somitogenesis and continuing through 48 h postfertilization(hpf) and suggested it as either adjacent or opposite to the tissues expressing raldh2. Endogenous RA produced by raldhs had no role in setting cyp26a1 expression in most of the tissues but exogenous RA regulated the expression of both enzymes.Shelton et al. (2006) found the upregulation of cyp26a1 in APCMIN mouse adenomas, human FAP adenomas, human sporadic colon carcinomas, and in the intestine of apcmcr mutant zebrafish embryos. Gongal et al. (2007) demonstrated the key role of Tgif in regulating RA signaling and patterning of forebrain. Loss of forebrain-specific RA degrading enzyme cyp26a1 caused forebrain phenotype that mimicked tgif morphants.White et al. (2007) showed the complex feedback and feedforward control of Retinoic acid and Fgf signaling on the expression of cyp26a1, the major RA-degrading enzyme during gastrulation. They predicted the consequence of such control to be the fluctuations in retinoic acid synthesis and adaptive changes of RA gradients in embryo length during gastrulaion.Hernandez et al. (2007) demonstrated the important role of cyp26a1 in protecting the embryo against the potentially teratogenic effects of maternally derived retinoic acid (RA) precursors. Both cyp26a1 and cyp26c1 are required to establish the anterior limit of hoxb1a expression at the r3-r4 boundary.Hu et al. (2008) analyzed 2,533 base pairs upstream genomic sequence of zebrafish cyp26a1 start codon and reported two Retinoic Acid Response Elements (RAREs) that are conserved in zebrafish cyp26a1 promoter. They induced mutagenesis and revealed the role of two RAREs in RA inducibility of the promoter. They established a stable transgenic line [Tg(cyp26a1:eYFP)] by microinjecting the construct of the promoter driving eYFP (enchanced yellow florescent protein) reporter gene and observed the similar expression pattern of reporter to that of endogenous cyp26a.
GeneCloning

GeneStructure This gene encodes two transcript. Transcript (ENSDART00000041728) consist of 4 exons and is 1,830 bps in length. The product (ENSDARP00000041727) Consist of 492 residues Transcript (ENSDART00000141212) consist of 4 exons and is 835 bps in length. The product (ENSDARP00000126883) Consist of 256 residues.
Protein ENSDARP00000041727
ProteinDomainandFamilies has domain InterPro:IPR002401; InterPro:IPR001128;
Motifs has motif Prosite:PS00086; PFAM:PF00067; PRINTS:PR00359; PRINTS:PR00385; PRINTS:PR00463; PRINTS:PR00465; UniProt:CP26A_DANRE;
Expression ArrayExpress:ENSDARG00000033999;
GeneOntology GO:0005792; GO:0016020; GO:0005579; GO:0006118; GO:0042573; GO:0001756; GO:0006826; GO:0006879; GO:0006783; GO:0048387; GO:0001568; GO:0030902; GO:0021661; GO:0042574; GO:0042221; GO:0005506; GO:0020037; GO:0004497; GO:0008401; GO:0046872; GO:0016491;
Orthologs Entrez:1592
VariationAndRepeats RSID:rs180119207; RSID:rs180119207; RSID:rs40811671; RSID:rs40811671; RSID:rs180119208; RSID:rs180119208; RSID:rs40791452; RSID:rs40791452; RSID:rs40836772; RSID:rs40836772
DisordersAndMutations Emoto et al. (2005) characterized a mutant of the zebrafish giraffe (gir), in which the gene for the RA-degrading enzyme Cyp26a1 is mutated. The gir mutant displayed patterning defects in multiple organs including the common cardinal vein, pectoral fin, tail, hindbrain, and spinal cord. They also found that wildtype embryos injected with 1ng of cyp26a1 antisense morpholino (cyp26a1-MO) 5 CGCGCAACTGATCGCCAAAACGAAA 3 showed shortened tail, no or small pectoral fins, and defect in blood cell circulation, thus phenocopying the gir mutant.Cyp26a1 induction following apc mutation is dependent on wnt signaling. Shelton et al. (2006) used tcf4 splice blocking morpholino 5 CTTATTTGTCACTTACCTCGGAATC 3 to knock down tcf and showed the reduced expression of cyp26a1 along with known wnt target genes.
RelatedPubMedArticles Dobbs-McAuliffe, B.; Zhao, Q.; Linney, E.: Feedback mechanisms regulate retinoic acid production and degradation in the zebrafish embryo. Mech Dev. ;121(4):339-50, 2004. PMID:15110044 Emoto, Y.; Wada, H.; Okamoto, H.; Kudo, A.: Imai Y. Retinoic acid-metabolizing enzyme Cyp26a1 is essential for determining territories of hindbrain and spinal cord in zebrafish. Dev Biol. ;278(2):415-27,2005. PMID:15680360 Shelton, D. N.; Sandoval, I. T.; Eisinger, A.; Chidester, S.; Ratnayake, A.; Ireland, C. M.; Jones, D. A.: Up-regulation of CYP26A1 in adenomatous polyposis coli-deficient vertebrates via a WNT-dependent mechanism: implications for intestinal cell differentiation and colon tumor development. Cancer Res. ;66(15):7571-7, 2006. PMID:16885356 Hernandez, R. E.; Putzke, A. P.; Myers, J. P.; Margaretha, L.; Moens, C. B.: Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development. ;134(1):177-87, 2007. PMID:17164423 White, R. J.; Nie, Q.; Lander, A. D.; Schilling, T. F.: Complex regulation of cyp26a1 creates a robust retinoic acid gradient in the zebrafish embryo. PLoS Biol. ;5(11):e304, 2007. PMID:18031199 Gongal, P. A.; Waskiewicz, A. J.: Zebrafish model of holoprosencephaly demonstrates a key role for TGIF in regulating retinoic acid metabolism. Hum Mol Genet. ;17(4):525-38.2008. Epub 2007 Nov 12. PMID:17998248 Hu, P.; Tian, M.; Bao, J.; Xing, G.; Gu, X.; Gao, X.; Linney, E.; Zhao, Q.: Retinoid regulation of the zebrafish cyp26a1 promoter. Dev Dyn.;237(12):3798-808. 2008. PMID:19035346 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-27 - ParasSehgal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort