Tags:
create new tag
, view all tags

cpox

coproporphyrinogen oxidase

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName cpox
Aliases ENSDARG:ENSDARG00000062025; cpo; cb535; sb:cb535; wu:fc43a01
Description coproporphyrinogen oxidase
GenomicLocation chromosome 8 19121105-19137938 reverse strand
ExternalIDs Entrez:321294; EMBL:AB180841; UniGene:78554; ZFIN:ZDB-GENE-030131-9884;
TranscriptID ENSDART:ENSDART00000089172; ENSDART:ENSDART00000127364
mRNA NCBI:NM_001040094
GeneDescription cpox is the sixth heme synthesis enzyme which is predominantly expressed in the ICM (intermediate cell mass) that is a major site of zebrafish eythropoiesis. It catalyzes the following reaction:coproporphyrinogen-III + O2 + 2 H+ = protoporphyrinogen-IX + 2 CO2 + 2 H2O.
GeneFunction Hanaoka et al. (2006) studied sequence and expression pattern of cpox and stated that cpox functions as heme synthesis enzyme in the blood cells in the zebrafish erythropoiesis.Hanaoka et al. (2006) found that coproporphyrinogen oxidase (CPO) was predominantly expressed in the intermediate cell mass (ICM) that is a major site of zebrafish primitive hematopoiesis.Hanaoka et al. (2006) demonstrated that over-expression of biklf and gata1 significantly induced ectopic CPO (coproporphyrinogen oxidase) expression.
GeneCloning cpox is contained in a BAC clone CH211-232D19 (Vector: pTARBAC2.1)
GeneStructure It encodes for two transcript Transcript (ENSDART00000089172) consist of 7 exons and is 1,944 bps in length. The product (ENSDARP00000083605) Consist of 449 residues. Transcript (ENSDART00000127364) consist of 7 exons and is 1,389bps in length. The product (ENSDARP00000008678) Consist of 449 residues.
Protein ENSDARP00000083605 ENSDARP00000108678
ProteinDomainandFamilies has domain InterPro:IPR001260; InterPro:IPR018375
Motifs has motif Prosite:PS01021; PFAM:PF01218; PRINTS:PR00073;
Expression ArrayExpress:ENSDARG00000062025;
GeneOntology GO:0006779; GO:0042541; GO:0004109;
Orthologs Entrez:1371
VariationAndRepeats RSID:rs40965656; RSID:rs41092933; RSID:rs180145466; RSID:rs180145466; RSID:rs40726054; RSID:rs40726054; RSID:rs40789970; RSID:rs40789970; RSID:rs40962628; RSID:rs40962628; RSID:rs41250959; RSID:rs41250959; RSID:rs40762011; RSID:rs40762011; RSID:rs41095401; RSID:rs41095401; RSID:rs41168633; RSID:rs41168633; RSID:rs41204770; RSID:rs41204770; RSID:rs40979356; RSID:rs40979356; RSID:rs41203938; RSID:rs41203938; RSID:rs41204558; RSID:rs41204558; RSID:rs40692167; RSID:rs40692167; RSID:rs40763239; RSID:rs40763239; RSID:rs41086966; RSID:rs41086966; RSID:rs40930280; RSID:rs40930280; RSID:rs40708173; RSID:rs40708173; RSID:rs40854624; RSID:rs40854624; RSID:rs40681837; RSID:rs40681837; RSID:rs41081690; RSID:rs41081690; RSID:rs40940662; RSID:rs40940662; RSID:rs41097652; RSID:rs41097652; RSID:rs41175704; RSID:rs41175704; RSID:rs40939421; RSID:rs40939421; RSID:rs41221121; RSID:rs41221121; RSID:rs40810004; RSID:rs40810004; RSID:rs41141183; RSID:rs41141183; RSID:rs41081994; RSID:rs41081994; RSID:rs41103363; RSID:rs41103363; RSID:rs40839303; RSID:rs40839303; RSID:rs40946622; RSID:rs40946622
DisordersAndMutations Hanaoka et al. (2006) found that knockdown of zebrafish CPOX using anti-sense morpholinos (CPO-MO) lead to a significant suppression of hemoglobin production without apparent reduction of blood cells.The morpholinos MO1-cpox (5' - GCACAAAGCTAACGAAGTCATGCTG - 3') and MO2-cpox (5' - TCTGCTGAGCGAACACGACGCAGTC - 3').
RelatedPubMedArticles Hanaoka, R.; Katayama, S.; Dawid, I.B.; Kawahara, A.: Characterization of the heme synthesis enzyme coproporphyrinogen oxidase (CPO) in zebrafish erythrogenesis. Genes Cells. 11(3):293-303, Mar 2006. PMID:16483317 . NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-26 - ParasSehgal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort