Tags:
create new tag
, view all tags

cdh23

cadherin-like 23

Rate Information on this Page
Score: 1, My vote: 0, Total votes: 1

GeneInformationForm
GeneName cdh23
Aliases ENSDARG:ENSDARG00000007561; cadherin 23, sputnik, spu , cadherin-like 23
Description cadherin-like 23
GenomicLocation chromosome 13 43723088-43875606 forward strand
ExternalIDs Entrez:407978; EMBL:AY530192; UniGene:92041; ZFIN:ZDB-GENE-040513-7;
TranscriptID ENSDART:ENSDART00000135231
mRNA NCBI:NM_214809
GeneDescription This gene is a member of the cadherin superfamily, genes encoding calcium dependent cell-cell adhesion glycoproteins. The protein encoded by this gene is a large, single-pass transmembrane protein.
GeneFunction Nicolson et al. (1998) reported that mutations in sputnik and mariner affect hair bundle integrity. The genes sputnik, cosmonaut, and orbiter have homozygous viable alleles that cause a recessive adult phenotype. The circling behavior of mutant sputnik adults consists mainly of forward somer-saulting and random lateral looping . Animal homozygous for orbiter rarely survive, but those that do exhibit lateral looping behavior similar to sputnik adults. Thus, sputnik and orbiter adult fish mimic the behavior of fish under micro- or zero-gravity conditions (von Baumgarten et al. 1975) and fish that have undergone lesions or removal of the vestibular organ (Pfeiffer, 1964).Sollner et al. (2004) reported that the defects in sputnik mutants are caused by mutations in cadherin 23 (cdh23). Mutations in Cdh23 also cause deafness and vestibular defects in mice and humans5–9, and the protein is present in hair bundles10,11. They showed that zebrafish Cdh23 protein is concentrated near the tips of hair bundles, and that tip links are absent in homozygous sputniktc317e larvae. Moreover, tip links are absent in larvae carrying weak alleles of cdh23 that affect mechanotransduction but not hair bundle integrity. Finally, they have concluded that conclude that Cdh23 is an essential tip link component required for hair-cell mechanotransduction.
GeneCloning

GeneStructure This gene encodes single transcript. Transcript ENSDART00000135231 consist of 13 exons and is 1704 bps in length. The protein product (ENSDARP00000119218) consist of 736 residues
Protein ENSDARP00000119218
ProteinDomainandFamilies InterPro:IPR002126 InterPro:IPR015919 InterPro:IPR020894
Motifs has motif Prosite:PS00232; PFAM:PF00028; PRINTS:PR00205;
Expression ArrayExpress:ENSDARG00000007561
GeneOntology GO:0016020; GO:0016021; GO:0005929; GO:0050974; GO:0006897; GO:0050957; [[GO:0007156]; GO:0030030; GO:0060122; GO:0007605; GO:0019855;
Orthologs Entrez;64072
VariationAndRepeats RSID:rs180164208; RSID:rs180117686; RSID:rs180117687; RSID:rs180117688; RSID:rs180117678; RSID:rs180117689; RSID:rs180117690; RSID:rs180164209; RSID:rs40635980; RSID:rs180117691; RSID:rs180117692; RSID:rs180117693; RSID:rs180117694; RSID:rs180117695; RSID:rs40749976; RSID:rs180117696; RSID:rs180117697; RSID:rs180117698; RSID:rs40988838; RSID:rs41082892; RSID:rs180117699; RSID:rs180117701; RSID:rs180117702; RSID:rs180117703; RSID:rs180117704; RSID:rs180117705; RSID:rs180164210; RSID:rs180117706; RSID:rs180117707; RSID:rs180117708; RSID:rs180117709; RSID:rs180117710
DisordersAndMutations MO1-cdh23 5' - CTCCCGAACCTTCACACCACGACAT - 3' used against chh23 gene.Sputnik mutant is an ENU based mutant, affected alleles are ru609, t23576, tc242b, tc317e, te370e, tj264, tz300.
RelatedPubMedArticles Nicolson, T.; Rüsch, A.; Friedrich, R.W.; Granato, M.; Ruppersberg, J.P.; Nüsslein-Volhard, C.:Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants. Neuron ;20(2):271-83, 1998. PMID:9491988 Seiler, C.; Nicolson, T.: Defective calmodulin-dependent rapid apical endocytosis in zebrafish sensory hair cell mutants. J Neurobiol.;41(3):424-34, 1999. PMID:10526320 Whitfield, T.T.: Zebrafish as a model for hearing and deafness. J Neurobiol. ;53(2):157-71, 2002(Review). PMID:12382273 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - ParasSehgal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort