Tags:
create new tag
, view all tags

cat

Catalase

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName cat
Aliases ENSDARG:ENSDARG00000004909; fb68a12; wu:fb68a12
Description Catalase
GenomicLocation chromosome 25 7801937-7811747 reverse strand
ExternalIDs Entrez:30068; EMBL:BC051626; UniGene:1079; ZFIN:ZDB-GENE-000210-20;
TranscriptID ENSDART:ENSDART00000149152; ENSDART:ENSDART00000007781; ENSDART:ENSDART00000123592
mRNA NCBI:NM_130912
GeneDescription Catalase is an antioxidant enzyme that plays a central role in the protection against oxidative stress through the metabolism of hydrogen peroxide.
GeneFunction Gerhard et al. (2000) cloned a zebrafish catalase cDNA containing the whole coding region and analysed the expression by both RT-PCR and western blots. The 3' flanking region of the cDNA contains a dinucleotide repeat near the termination codon consisting of a near perfect CA array that is polymorphic. A stem-loop structure was also predicted adjacent to the zebrafish CA repeat ,suggesting a similar role in catalase gene regulation.Catalase plays a central role in the protection against oxidative stress through the metabolism of hydrogen peroxide.Hirayama et al. (2007) showed that overexpression of cat results in reduced Cry1a nd Per2 gene induction in zebrafish.And inhibition of Cat function leads to enhanced light mediated inducibility of clock gene, thus this shws that zCat plays a negative regulation role in light depented gene transcriptional activation.
GeneCloning Gerhard et al. (2000) cloned a zebrafish catalase cDNA containing the whole coding region and analysed the expression by both RT-PCR and western blots. The 3' flanking region of the cDNA contains a dinucleotide repeat near the termination codon consisting of a near perfect CA array that is polymorphic. A stem-loop structure was also predicted adjacent to the zebrafish CA repeat ,suggesting a similar role in catalase gene regulation.
GeneStructure This gene encodes for a three transcripts Transcript ENSDART00000007781 consist of 13 exons and is 2237bps in length. The protein product (ENSDARP00000013402) consist of 526 residues Transcript ENSDART00000149152 consist of 12 exons and is 2054bps in length. The protein product (ENSDARP00000124779) consist of 504 residues Transcript ENSDART00000123592 consist of 15 exons and is 1636bps in length. The protein product (ENSDARP00000107673) consist of 526 residues
Protein ENSDARP00000124779 ENSDARP00000013402 ENSDARP00000107673
ProteinDomainandFamilies has domain InterPro:IPR002226; InterPro:IPR011614;
Motifs has motif Prosite:PS00437; PFAM:PF00199; PRINTS:PR00067;
Expression ArrayExpress:ENSDARG00000004909;
GeneOntology GO:0005777; GO:0006118; GO:0006979; GO:0006783; GO:0006826; GO:0006879; GO:0004096; GO:0005506; GO:0004601; GO:0046872; GO:0016491;
Orthologs Entrez:847
VariationAndRepeats RSID:rs41148359; RSID:rs41108189; RSID:rs41149977; RSID:rs41035008; RSID:rs41169778; RSID:rs40878030; RSID:rs40992950; RSID:rs41167280; RSID:rs41121784; RSID:rs40676133; RSID:rs40648978; RSID:rs40753661
DisordersAndMutations Morpholino MO1-cat (5' - TCGACTTTTCTCTGTCGTCTGCCAT - 3') has been used against this gene.
RelatedPubMedArticles Gerhard, G.S.; Kauffman, E.J.; Grundy, M.A.: Molecular cloning and sequence analysis of the Danio rerio catalase gene. Comp Biochem Physiol B Biochem Mol Biol; 127(4):447-57,2000. PMID:11281262 .Hirayama, J.; Cho, S.; Sassone-Corsi, P.: Circadian control by the reduction/oxidation pathway: catalase represses light-dependent clock gene expression in the zebrafish.Proc Natl Acad Sci U S A. 2;104(40):15747-52,2007. PMID:17898172 .NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - ParasSehgal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort