Tags:
create new tag
, view all tags

casp9

caspase 9, apoptosis-related cysteine protease

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName casp9
Aliases ENSDARG:ENSDARG00000004325; im:7136887, zgc:101776
Description caspase 9, apoptosis-related cysteine protease
GenomicLocation chromosome 23 25261112-25272611 forward strand
ExternalIDs Entrez:492763; EMBL:BC085434; UniGene:78866; ZFIN:ZDB-GENE-030825-5;
TranscriptID ENSDART:ENSDART00000047020; ENSDART:ENSDART00000137574
mRNA NCBI:NM_001007404
GeneDescription Caspase 9 is a member of caspase family.It is been linked to the mitochondrial death pathway. It is activated during programmed cell death
GeneFunction Kratz et al. (2006) found caspase 9 associated with proapoptotic factors as he found it to be stimulated with the subsequent release of proapoptoyic factors from mitochondrion. Eimon et al. (2006) injected caspase 9 mRNA in zebrafish embryos which induced apoptosis. Inohara et al. ( 2000) searched expressed-sequence tags (EST) public databases for zebrafish homologs proteins using TBLAST and identified caspase 9 with significant homology to mammalian caspases containing recognizable caspase-recruitment domains (CARDs), as they are found in their mammalian counterparts also.
GeneCloning casp9 is contained in BAC clone named DKEY-7I1(Library: Daniokey; Vector: pIndigoBAC-536)
GeneStructure It encodes for two transcripts.(ENSDART00000047020)which consists of 10 exons and is 1,734 bps in length .The protein product (ENSDARP00000047019) consists of 436 residues.Transcript ENSDART00000137574 consists of 2 exons and is 658 bps in length. No protein product.
Protein ENSDARP00000047019
ProteinDomainandFamilies has domain InterPro:IPR001309; InterPro:IPR002398; InterPro:IPR015917; InterPro:IPR002138; InterPro:IPR011600; InterPro:IPR017350; InterPro:IPR001315; InterPro:IPR011029; InterPro:IPR016129;
Motifs has motif Prosite:PS01121; Prosite:PS01122; Prosite:PS50207; Prosite:PS50208; Prosite:PS50209; PFAM:PF00619; PFAM:PF00656; PRINTS:PR00376;
Expression ArrayExpress:ENSDARG00000004325;
GeneOntology GO:0043065; GO:0005622; GO:0004197
Orthologs Entrez:842;
VariationAndRepeats RSID:rs180023801; RSID:rs180023858; RSID:rs180023647; RSID:rs180023778; RSID:rs41202513; RSID:rs40792088; RSID:rs180023669; RSID:rs180023739; RSID:rs180023864; RSID:rs180023888; RSID:rs180023805; RSID:rs180023552; RSID:rs180023733; RSID:rs180023548; RSID:rs180023543; RSID:rs180023772; RSID:rs180023837; RSID:rs180023837; RSID:rs180023812; RSID:rs180023812; RSID:rs180023611; RSID:rs180023611; RSID:rs180023474; RSID:rs180023474; RSID:rs180023760; RSID:rs180023760; RSID:rs180023579; RSID:rs180023579; RSID:rs180023560; RSID:rs180023560; RSID:rs180023804; RSID:rs180023804; RSID:rs180023622; RSID:rs180023622; RSID:rs180023642; RSID:rs180023642; RSID:rs180023889; RSID:rs180023889; RSID:rs180023617; RSID:rs180023617; RSID:rs180023562; RSID:rs180023562; RSID:rs180023550; RSID:rs180023550; RSID:rs180023890; RSID:rs180023890; RSID:rs180023661; RSID:rs180023661; RSID:rs180023509; RSID:rs180023509; RSID:rs180023745; RSID:rs180023745; RSID:rs180023538; RSID:rs180023538
DisordersAndMutations Morpholino MO1-casp9(5' - GATGGAAAAACACACTTACGGACTG - 3') has been directed against caspase 9. Apoptosis was observed in the spinal cord.
RelatedPubMedArticles Inohara,N.;Nunez, G.: Genes with homology to mammalian apoptosis regulators identified in Zebrafish.Cell Death Differ. ;7(5):509-10, 2000. PMID:10917738 .Kratz, E.; Eimon, P.M.; Mukhyala, K.; Stern, H.; Zha, J.; Strasser, A.; Hart, R.; Ashkenazi A.: Functional characterization of the Bcl-2 gene family in the zebrafish .Cell Death Differ.;13(10):1631-40, 2006. PMID:16888646 Eimon, P.M.; Kratz, E., Varfolomeev, E., Hymowitz, S.G., Stern, H., Zha, J., and Ashkenazi, A. Delineation of the cell-extrinsic apoptosis pathway in the Zebrafish.Cell Death Differ.;13(10):1619-30, 2006. PMID:16888647 . NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - ParasSehgal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort