Tags:
create new tag
, view all tags

casp8

caspase 8, apoptosis-related cysteine peptidase

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName casp8
Aliases ENSDARG:ENSDARG00000058325; caspase-8a, zgc:92075
Description caspase 8, apoptosis-related cysteine peptidase
GenomicLocation chromosome 6 12957805-12968646 forward strand
ExternalIDs Entrez:58022; EMBL:AY518734; UniGene:10334; ZFIN:ZDB-GENE-000713-1;
TranscriptID ENSDART:ENSDART00000104757
mRNA NCBI:NM_131510
GeneDescription Caspase 8 is a member of caspase family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspase 8 is an initiative caspase which activates other members of caspase family.
GeneFunction Amali et al. (2006) found a correlation between caspase 8 and apoptosis. It is also found associated with accumulation of fatty droplets which causes the pushing of the nucleus towards one side finally leading to steatohepatitis (fat degeneration) in liver. Eimon et al. (2006) correlated caspase 8 to be associated with DISC (death inducing signallin complex). and also as an initiative caspase, which activates effector caspases leading to programmed cell death. Inohara et al. ( 2000) searched expressed-sequence tags (EST) public databases for zebrafish homologs proteins using TBLAST and identified bad with significant homology to mammalian apoptosis genes. He identified Caspase-8 contained in death effector domains (DED). Sakata et al. (2007) compared zebrafish casp8 gene to that of the mammalian casp8 gene and characterized them with similar genomic organization. They transfected zebrafish casp 8 in mammals which showed pro-apoptotic activity, inducing cell death . Zebrafish Casp8 activates the caspase cascade associated with activation of downstream effector caspases and leads to apoptotic cell death in mammalian cells. They also hypothesized casp8, casp10 and cflar genes phylogenetically related as Cflar is an important regulator of Casp8 .Stanson et al. (2006) correlated caspase 8 with yaf2 and showed their interaction causes inhibition of caspase 8 mediated apoptosis.Hong et al. (2005) studied the correlatin between caspase 8 and infectious pancreatic necrosis virus (IPNV). He investigated that IPNV activated caspase 8 at low temperature (18 C) from 1.5-2 times more apoptosis induced.
GeneCloning

GeneStructure It encodes a single transcripts.(ENSDART00000104757) consists of 10 exons and is 2,027 bps in length. The protein product (ENSDARP00000095527) consists of 476 residues.
Protein ENSDARP00000095527
ProteinDomainandFamilies has domain InterPro:IPR001309; InterPro:IPR002398; InterPro:IPR015917; InterPro:IPR002138; InterPro:IPR011600; InterPro:IPR016129; InterPro:IPR001875; InterPro:IPR011029;
Motifs has motif Prosite:PS01122; PFAM:PF00656; PFAM:PF01335; PRINTS:PR00376;
Expression ArrayExpress:ENSDARG00000058325;
GeneOntology GO:0043065; GO:0004197
Orthologs Entrez:841;
VariationAndRepeats RSID:rs40633559; RSID:rs41068895; RSID:rs41211930
DisordersAndMutations Morpholino MO1-casp8 (5' - ACAGGGTTTTAACTCACAGTAGATC - 3') has been directed against caspase 8.The embryos showed apoptosis.
RelatedPubMedArticles Amali, A.A.; Rekha, R.D.; Lin, C.J.; Wang, W.L.; Gong, H.Y.; Her, G.M.; Wu, J.L.: Thioacetamide induced liver damage in zebrafish embryo as a disease model for steatohepatitis. PMID:16456712 .Eimon, P.M.; Kratz, E.; Varfolomeev, E.; Hymowitz, S.G.; Stern, H.; Zha, J.; Ashkenazi, A.: Delineation of the cell-extrinsic apoptosis pathway in the zebrafish . PMID:16888647 .Inohara,N.;Nunez, G.: Genes with homology to mammalian apoptosis regulators identified in Zebrafish. PMID:10917738 .Sakata, S.I.; Yan, Y.; Satou, Y.; Momoi, A.; Ngo-Hazelett, P.; Nozaki, M.; Furutani-Seiki, M.; Postlethwait, J.H.; Yonehara, S.; Sakamaki, K.: Conserved function of caspase-8 in apoptosis during bony fish evolution. PMID:17459614 .Stanton, S.E,; McReynolds, L.J.; Evans, T.; Schreiber-Agus, N.: Yaf2 Inhibits Caspase 8-mediated Apoptosis and Regulates Cell Survival during Zebrafish Embryogenesis. PMID: 16891308 Hong, J.R.; Huang, L.J.; Wu, J.L.: Aquatic birnavirus induces apoptosis through activated caspase-8 and -3 in a zebrafish cell line. NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - ParasSehgal
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort