Tags:
create new tag
, view all tags

bmper

BMP binding endothelial regulator

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName bmper
Aliases ENSDARG:ENSDARG00000040893; cvl2, id:ibd5071, Crossveinless 2
Description BMP binding endothelial regulator
GenomicLocation chromosome 16 9251505-9291853 reverse strand
ExternalIDs Entrez:338246; UniGene:38460; ZFIN:ZDB-GENE-030219-146;
TranscriptID ENSDART:ENSDART00000097348; ENSDART:ENSDART00000059930
mRNA NCBI:NM_001020487
GeneDescription BMPER is an endothelial cell regulator and controls bone morphogenetic protein-4dependent angiogenesis.
GeneFunction Moser et al.(2007) identified BMPER (BMP endothelial cell precursor derived regulator) and demonstrated its spatiotemporal expression at sites of vasculogenesis and direct modulation of BMP activity. The generation of the caudal vein is compromised and the pattern guiding of the intersomitic vessels is disturbed, indicating that zbmper is required for early steps in vascular pattern formation and hematopoiesis in zebrafish.
GeneCloning (Moser et al 2007) cloned BMPER ortholog in zebrafish (zbmper), directly to investigate its role in vascular development. zbmper expression was observed at sites of high BMP activity, including vascular precursor cells located in the aortic arches and the intermediate cell mass during zebrafish embryonic development.
GeneStructure This gene encodes for 2 transcripts. The transcript ENSDART00000059930 consists of 20 exons and is 1.992 bps in length. The protein product ENSDARP00000059929 consists of 663 residues.The transcript ENSDART00000097348 consists of 16 exons and is 2.004 bps in length. The protein product ENSDARP00000088118 consists of 667 residues
Protein ENSDARP00000088118 ENSDARP00000059929
ProteinDomainandFamilies has domain InterPro:IPR001846; InterPro:IPR014853; InterPro:IPR001007;
Motifs has motif Prosite:PS01208; Prosite:PS50184; Prosite:PS51233; PFAM:PF00093; PFAM:PF00094; PFAM:PF08742;
Expression ArrayExpress:ENSDARG00000040893;
GeneOntology GO:0005615; GO:0005578; GO:0030510; GO:0005515; GO:0050840; GO:0030097; GO:0001568;
Orthologs Entrez:168667;
VariationAndRepeats RSID:rs180098863; RSID:rs180098863; RSID:rs180030474; RSID:rs180030474; RSID:rs180030473; RSID:rs180030473; RSID:rs180030472; RSID:rs180030472; RSID:rs180030471; RSID:rs180030471; RSID:rs180176390; RSID:rs180176390; RSID:rs180030462; RSID:rs180030462; RSID:rs180030456; RSID:rs180030456; RSID:rs180030440; RSID:rs180030440; RSID:rs180030424; RSID:rs180030424
DisordersAndMutations Moser et al. (2007) showed that knockdown of zbmper using Morpholino oligonucleotide resulted in a dorsalized phenotype in addition to a reduced number of gata1 expressing hematopoietic precursor cells and circulating blood cells as well as a vascular phenotype was observed . The MOs were designed to inhibit translation or splicing of the zbmper RNA (Genbank GB accession number DQ386454). The two different MOs utilized were as followes: zbmper MO1: TTGGATGATCTTACCGGTGATTAAA; zbmper MO2: CCAAAGTATCCCAAGCCTGTAGAAA. MO1 targets the first exon–intron splicing site of zbmper mRNA and MO2 was directed against the untranslated region. One or two cell stage embryos were injected either MOs and raised at 28.5 °C until analyzed. Zbmper protein was quantified in zebrafish embryo lysates using standard western blotting techniques and an antibody from R&D systems.ZFINID:ZDB-GENO-100505-19;
RelatedPubMedArticles Moser,M.; Yu, Q.;Bode, C.;Xiong,J.W.;Patterson,C.:BMPER is a conserved regulator of hematopoietic and vascular development in zebrafish.J Mol Cell Cardiol. ;43(3):243-53.2007.Epub 2007. PMID:1761864 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-09 - DivyaJagga02
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort