Tags:
create new tag
, view all tags

bmp5

bone morphogenetic protein 5

* Set ALLOWTOPICCHANGE = TWikiAdminGroup

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0
GeneInformationForm
GeneName bmp5
Aliases ENSDARG:ENSDARG00000004965; MGC64230; zgc:64230; bmp5
Description bone morphogenetic protein 5
GenomicLocation chromosome Zv9_scaffold3454 26981-53287 forward strand
ExternalIDs Entrez:394026; EMBL:BC054647; UniGene:81712; ZFIN:ZDB-GENE-040426-1413;
TranscriptID ENSDART:ENSDART00000019239
mRNA NCBI:NM_201051
GeneDescription Thisse et al.(1999) studied phylogenetic relation between antivin (novel TGF- beta family gene) and TGF-beta super family genes including bmp5.
GeneFunction Thisse et al.(2004) studied the localization of bmp5 in periderm,phayngeal arch 3-7 skeleton,presumptive retina of zebrafish,using in situ hybridization.Holzschuh et al.(2005) using a genetic interference approach identified bmp5 as a crucial component of the endodermal signals that induce epibranchial neurogenesis.
GeneCloning Holzschuh et al.(2005) cloned Zebrafish bmp5 into the pSPORT vector. A cDNA encoding bmp5 was isolated from a gridded zebrafish pharyngula-stage (24 hpf) library using human BMP7 as a probe and was cloned into the pSPORT vector.
GeneStructure This gene encodes for single transcript.Transcript ENSDART00000019239 consists of 12 Exons and is 1,341 in length.The Protein product (ENSDARP00000019985) consists 446 residues.
Protein ENSDARP00000019985
ProteinDomainandFamilies has domain InterPro:IPR001839; InterPro:IPR017948; InterPro:IPR001111; InterPro:IPR015615;
Motifs has motif Prosite:PS00250; Prosite:PS51362; PFAM:PF00019; PFAM:PF00688;
Expression ArrayExpress:ENSDARG00000004965;
GeneOntology GO:0040007; GO:0008083; GO:0005576;
Orthologs Entrez:653;
VariationAndRepeats

DisordersAndMutations Holzschuh et al.(2005) (Morpholino studies) used morpholino oligomers to target the translation start site of bmp5 (GenBank #NM 201051 CCACAGAAGTTCCAAATGTTCTCAT) and found that 1 ng of the bmp5-MO caused a slight reduction in head size, but otherwise no clear phenotype on its own, but effectively reduced epibranchials when injected into endoderm. A similar result was obtained using a second, non-overlapping bmp5-MO.
RelatedPubMedArticles Thisse,C.; Thisse,B.:Antivin, a novel and divergent member of the TGFbeta superfamily, negatively regulates mesoderm induction. Development. ;126(2):229-40.1999. PMID:9847237 Holzschuh,J.; Wada,N.; Wada,C.; Schaffer,A.; Javidan,Y.; Tallafuss, A.; Bally-Cuif,L.; Schilling, T.F.: Requirements for endoderm and BMP signaling in sensory neurogenesis in zebrafish. Development. ;132(16):3731-42,2005. PMID:16077092 Thisse, B., Thisse, C. Fast Release Clones: A High Throughput Expression Analysis SOURCE: ZFIN Direct Data SubmissionNCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-08-09 - DivyaJagga02
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort