Tags:
create new tag
, view all tags

bcl2l10

BCL2-like 10 (apoptosis facilitator)

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName bcl2l10
Aliases ENSDARG:ENSDARG00000026766; nr13; NR-13; mcl1l; sb:cb78
Description BCL2-like 10 (apoptosis facilitator)
GenomicLocation chromosome 18 37544009-37556294 forward strand
ExternalIDs Entrez:373113; EMBL:BC107624; UniGene:78077; ZFIN:ZDB-GENE-030825-2;
TranscriptID ENSDART:ENSDART00000030838; ENSDART:ENSDART00000122377
mRNA NCBI:NM_194398
GeneDescription In humans, the protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family, including BCL2, BCL2L1/BCL-X(L), and MCL1, and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified.
GeneFunction Arnaud et al. (2006) characterized Nrz, a new Bcl-2-related inhibitor of apoptosis in zebrafish. Nrz is a mitochondrial protein, antagonizing the death-accelerator Bax. This gene was found to be mainly expressed during gastrulation and somitogenesis. The knockdown of nrz with antisense morpholinos was found to lead to alterations of the somites. These changes correlated with an increase in apoptosis. In addition, earlier during development, in the zebrafish gastrula, nrz knockdown results in an increase of snail-1 expression at the margin and frequent gastrulation arrest at the shield stage, independently of apoptosis. They concluded that the data suggested that Nrz, in addition to its effect on apoptosis, contributed to cell movements during gastrulation by negatively regulating the expression of Snail-1, a transcription factor that controls cell adhesion.
GeneCloning This gene is cloned in the vector pME18S-FL3 and is available as MGC:123143.
GeneStructure This gene encodes for two transcripts. The transcript ENSDART00000030838 consists of 3 exons and is 1.351 bps in length. The protein product ENSDARP00000037180 consists of 203 residues.The transcript ENSDART00000122377 consists of 3 exons and is 1.349 bps in length. The protein product ENSDARP00000108208 consists of 176 residues.
Protein ENSDARP:ENSDARP00000037180 ENSDARP:ENSDARP00000108208
ProteinDomainandFamilies has domain InterPro:IPR002475;
Motifs has motif Prosite:PS01258; Prosite:PS50062; PFAM:PF00452; PRINTS:PR01862; PRINTS:PR01866; PRINTS:PR01867;
Expression ArrayExpress:ENSDARG00000026766;
GeneOntology GO:0044429; GO:0042981; GO:0007369; GO:0043066; GO:0001756;
Orthologs Entrez:598;
VariationAndRepeats RSID:rs40711830;
DisordersAndMutations MO1-bcl2l10: 5' - CATTTTCCTCCCAGCGATGTCAGAC - 3'
RelatedPubMedArticles Arnaud, E.; Ferri, K.F.; Thibaut, J.; Haftek-Terreau, Z.; Aouacheria, A.; Le, Guellec. D.; Lorca, T.; Gillet, G.: The zebrafish bcl-2 homologue Nrz controls development during somitogenesis and gastrulation via apoptosis-dependent and -independent mechanisms. : Cell Death Differ. ;13(7):1128-37, 2006. PMID:16282981NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2014-01-09 - MeghnaSingh
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort